Labshake search
Citations for Roche :
451 - 500 of 3664 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The blot was then developed with DIG wash and block buffer set (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primers (Oligomer) and probes (Oligomer and Roche Applied Sciences) were ...
-
bioRxiv - Biochemistry 2020Quote: ... Details of primers and Universal Probe Library probes (Roche) and primers used can be found in Table S1.
-
bioRxiv - Biochemistry 2020Quote: ... Details of primers and Universal Probe Library probes (Roche) can be found in Table S1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with primer-appropriate Universal ProbeLibrary probes (Roche, Basel, Switzerland) and the ABI 7500 FAST qPCR system (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... using gene-specific primers and KAPA SYBR (KAPA Biosystems), on a Bio-Rad CFX96 real-time PCR machine ...
-
bioRxiv - Plant Biology 2021Quote: ... Primers were designed using the Universal Probe Library (Roche, https://lifescience.roche.com/en_de/brands/universal-probe-library.html#assay-design-center ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers were designed using Universal Probe library from Roche Diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... Complementary DNA (cDNA) was synthesized using random primers (Roche) and the High-Capacity cDNA Reverse Transcription kit (Life Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... and primers (Table SE4) in a LightCycler 96 (Roche). Melt curves were used to confirm a single amplification product and the LightCycler 96 Application Software (Roche ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene–specific primers (primer No.9–14) and a KAPA Biosystems kit (Roche, KAPA HiFi HotStart). The PCR conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RT-qPCR was performed after addition of SybrGreen (Roche). Expression relative to a normalization gene was calculated from Ct values according to the efficiency and delta delta Ct method ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR were performed using Light Cycler 480 (Roche) with the Light Cycler 480 SYBR Green I Master Kit (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR was performed with a LightCycler480 II (Roche). Relative gene expression was determined with the comparative CT method ...
-
bioRxiv - Cell Biology 2022Quote: ... and RT-qPCR analysis was performed using SybrGreen (Roche) to detect PIP4K2B expression ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-qPCR was run on a Lightcycler 480 (Roche) and Ct values obtained using the second derivative ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) as described before 4.
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed on a Lightcycler 96 (Roche). The following Taqman probes (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RTqPCR kit (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler 480 (Roche) with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RTqPCR kit (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-qPCR was run on a LightCycler 480 (Roche) and Ct values obtained using the second derivative ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR experiments were done using LightCycler LC480 (Roche). All reactions were made in quadruplicate for samples originated from at least three distinct litters.
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed in a LightCycler 480 (Roche) with PerfeCTa SYBR Green Supermix (Quantabio) ...
-
FTSH3 facilitates complex I degradation through a direct interaction with the complex I subunit PSSTbioRxiv - Plant Biology 2023Quote: ... RT-qPCR was carried out in LightCycler 480 (Roche) using SYBR Green master mix (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... RT - qPCR was performed on the LightCycler 480 (Roche) using the TaqMan FAST Universal Mastermix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR experiments were performed in a lightcycler (ROCHE) device ...
-
bioRxiv - Developmental Biology 2024Quote: ... and developed at RT in BM Purple (Roche 11442074001). Reactions were stopped with PBS and fixed with 4% PFA overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by hybridization capture using a custom-designed SeqCap Target Enrichment probe set (Roche) targeting coding and canonical splice regions (+/-2 bp ...
-
Interdependent Iron and Phosphorus Availability Controls Photosynthesis Through Retrograde SignalingbioRxiv - Plant Biology 2021Quote: ... we used adapters from the KAPA Biosystems Single-Indexed Adapter Set A+B (Roche). Before pooling the libraries ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR reactions were set with Light Cycler 480 SYBR Green I Master mix (Roche), 2 μl of cDNA and 0.3 μM primers (Extended Data Table 3) ...
-
bioRxiv - Plant Biology 2021Quote: ... WTK4 transcript accumulation was confirmed by PCR amplification using the primers JS693xJS671 followed by a semi-nested reaction with primers JS696xJS671 using KAPA Hifi HotStart Polymerase (KK2502, Kapa Biosystems, Hoffmann-La Roche) with an annealing temperature of 60°C and extension time of 3 min ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted from Lipo246 and Lipo815 cell lines and Reverse transcription (RT) reactions were carried out using Transcriptor RT enzyme (Roche Diagnostics, Basel, Switzerland). Nested PCR was performed using a 2-step PCR reaction as previously described(31).
-
bioRxiv - Genomics 2019Quote: RNA primers were removed with RNAse A/T1 Mix (Roche) for 60 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... with primers (Oligomer) and probes (Oligomer or Roche Applied Science) reported in Vihervaara et al ...
-
bioRxiv - Immunology 2020Quote: ... Gene-specific primers were designed using Universal Probe Library (Roche) and real-time PCR performed using GoTaq qPCR Master mix (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized with random p(dN)6 primers (Roche) and MMLV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.3 μg/uL of random primers p(DN) (Roche) at 65°C for 5 min ...
-
bioRxiv - Physiology 2020Quote: ... Primers were designed using the ProbeFinder software (Roche Applied Sciences). qRT-PCR was performed in triplicate with a MyiQ single-color real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was synthesized with random primers p(dN)6 (Roche) using SuperScript III Reverse Transcriptase (Invitrogen) ...