Labshake search
Citations for Roche :
551 - 600 of 5877 citations for Two Hybrid System Construction kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... was included to remove genomic DNA (Roche Molecular Systems, Mannheim, Germany). RNA integrity was validated using the Agilent RNA 6000 Pico Assay according to the manufacturer’s instructions (Agilent Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... on a Light Cycler LC480 Real-Time PCR system (Roche, France) in 384 well plates with 2 ng of equivalent RNA per point of qPCR ...
-
bioRxiv - Plant Biology 2020Quote: ... The RT-qPCR was performed on a LightCycler 480 System (Roche). ACTIN2 (AT3G18780 ...
-
bioRxiv - Cancer Biology 2019Quote: ... we used a cell death detection ELISA (Roche Molecular Systems, Inc.), which is an analytical quantitative sandwich enzyme immunoassay technique that uses the interaction the mouse monoclonal antibodies with DNA and histone to detect internucleosomal fragmented DNA ...
-
bioRxiv - Genetics 2020Quote: ... in 10 μL volumes using the LightCycler® 480 System (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... on the LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). ORF 1ab was amplified from cDNA and cloned into MS2-nCoV-ORF1ab and used as the plasmid standard after its identity was confirmed by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... TA muscle tissue was destroyed using the MagNa Lyser System (Roche). RNA concentration was evaluated with Nanodrop ...
-
bioRxiv - Cell Biology 2020Quote: ... Individual membranes were visualized using the enhanced chemiluminescence system (Roche Diagnostics).
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR assays were performed on the LightCycler 480 System (Roche).
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative PCR was performed with the Applied BiosystemsTM PowerUP™ SYBR™ Green Master Mix from Applied Biosystems on a real-time PCR instrument (LightCycler® 480 System, Roche) using the primers listed in Supplementary Table 2.
-
bioRxiv - Plant Biology 2021Quote: ... in a LightCycler 480 Real-Time PCR System (Roche, Basal, Switzerland). Expression levels were normalized by ACTIN2 (ACT2) ...
-
bioRxiv - Microbiology 2020Quote: ... The total RNA was isolated with MagNa Pure-96 System (Roche) in a final vol of 100 μL ...
-
bioRxiv - Cell Biology 2020Quote: ... and S1PR3 mRNA expression via the LightCycler® 480 System (Roche). Relative mRNA levels were quantified with the ΔCT method ...
-
bioRxiv - Cell Biology 2021Quote: ... using LightCycler ® 96 Real-Time PCR System (Roche Life Science). The specificity of the primers was verified with a single peak in the melt curve ...
-
bioRxiv - Cell Biology 2021Quote: ... The real time PCR was performed on a LightCycler480 system (Roche) using SYBR Green Master Mix (Roche ...
-
bioRxiv - Bioengineering 2020Quote: ... RT-qPCR was performed with the Light Cycler 480 system (Roche) using Sensifast Bioline Mix (Bio-Line) ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed in the Light Cycler 96 System (Roche) using Luna Universal qPCR Master Mix (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... on a LightCycler 480 Real-Time PCR System (Roche, Applied Science).2 µL (3 ng ...
-
bioRxiv - Microbiology 2022Quote: ... and qPCR assays were carried out in a LightCycler96 system (Roche), using MESA BLUE qPCR kit for SYBR assay (Eurogentec ...
-
bioRxiv - Physiology 2023Quote: ... DNA was isolated with the MagNaPure System (Roche Diagnostics, Mannheim, Germany) from mononuclear cells after lysis of erythrocytes ...
-
bioRxiv - Microbiology 2023Quote: ... on a Roche LightCycler 480 System (Roche Applied Science, Mannheim, Germany). Primers used for qPCR were followed ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA) ...
-
bioRxiv - Neuroscience 2023Quote: ... The Light Cycler® 480 Real-Time PCR System (Roche, Germany) was used to perform qPCR.
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR reaction was done using the LightCycler 480 system (Roche). Gene expression levels were calculated as 2-ΔCT normalized with the average CT of the housekeeping gene Tbp or Gapdh ...
-
bioRxiv - Genomics 2023Quote: ... and the Roche LightCycler 480 Instrument (Roche Molecular Systems, Inc., Germany). DNA integrity was inspected using 0.8% agarose gel electrophoresis with 0.5x TBE buffer and a 1 kilo base pairs (Kbp ...
-
bioRxiv - Plant Biology 2023Quote: ... following the manufacturer’s instructions using the LightCycler 480 system (Roche Diagnostics). Fold changes were calculated using the ΔCt method ...
-
bioRxiv - Genomics 2023Quote: ... and the Kapa HiFi Uracil+ PCR system (cat#: KK2801, Kapa Biosystems) with the following cycling parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was conducted using a Roche LightCycler 480 system (Roche) with three biological replicates ...
-
bioRxiv - Genomics 2023Quote: ... on a 384-well LightCycler 480 Real-Time PCR System (Roche) and threshold cycle (Ct ...
-
bioRxiv - Plant Biology 2023Quote: ... and a BIORAD camera system or a Lumi Imager F1 (Roche). Signal detection times were adjusted in a way that sufficiently strong signals above background were achieved ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Quantitative PCR (qPCR) was performed on a LightCycler 480 System (Roche) using LightCycler 480 SYBR Green I Master Mix reagents (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... Fluorescence signals were detected by a LightCycler 480 system (Roche Diagnostics).
-
bioRxiv - Microbiology 2023Quote: ... on the MagNA Pure 96 system (Roche Diagnostics GmbH (Manheim, Germany)).
-
bioRxiv - Microbiology 2023Quote: ... we extracted DNA with the MagnaPure 96 System (Roche, Basilea, Switzerland) and quantified it with a Qubit® 2.0 Fluorometer ...
-
bioRxiv - Genomics 2023Quote: ... in a LightCycler 96 Real-Time PCR System (Roche Applied Science). All reactions were performed in triplicates ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using a 3X KAPA Pure Bead clean up (Roche Molecular Systems). DNA was then eluted in 90 μl of EB ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR was performed in a LightCycler 96 System (Roche, Basel, Switzerland) with a temperature profile of 180 s at 95°C ...
-
bioRxiv - Cell Biology 2024Quote: ... A Roche Lightcycler 480 system (Roche Diagnostics, Neuilly-sur-Seine, France) was used for real-time RT-PCR following the protocol from Plagnes et al ...
-
bioRxiv - Bioengineering 2024Quote: ... the samples were placed in LightCycler® 96 System (Roche, Canada). The reaction was initiated with an initial denaturation step at 95°C for 10-30 seconds with detection turned off ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR analyses were performed using the Lightcycler480 system (Roche diagnostics) and SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed on a Real-time system (Roche) using SYBR green supermix (Vazyme) ...
-
bioRxiv - Genomics 2022Quote: ... High Sensitivity DNA Analysis Kit and KAPA SYBR FAST qPCR Kit (Roche). WGS was performed on the HiSeq X (HCS HD 3.5.0.7 ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNase free kit (Roche). RNA amount was quantified and cDNA was prepared using TaqMan Reverse Transcription Reagents (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by library preparation with KAPA RNA HyperPrep kit (Roche, kit code KK8541), according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Expression was quantified by the LightCycler® 480 System (Roche, Basel, Switzerland) using LightCycler® 480 SYBR Green I Master (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed on the LightCycler 480 System (Roche, Basel, Switzerland) using Kapa SYBR Fast Universal Kit (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR reactions were performed using the Universal Probe Library system (Roche) and a SensiFast Probe kit (Bioline) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real time PCR was performed using a LightCycler 480 system (Roche) with the LightCycler 480 SybrGreen I Master mix ...
-
bioRxiv - Zoology 2022Quote: qPCR was performed using the Roche LightCycler 96 system (Roche, Mannheim, Germany) with Thunderbird SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Neuroscience 2021Quote: ... on a LightCycler 480 Instrument II Real-Time PCR Detection System (Roche). Primer sequences are provided in the Table 1 ...