Labshake search
Citations for Roche :
651 - 700 of 3679 citations for Tonsoku Like DNA Repair Protein TONSL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... DNA was transferred to a positively charged nylon membrane (Roche) and then crosslinked by UV irradiation ...
-
bioRxiv - Plant Biology 2020Quote: ... reverse transcriptase and KAPA HiFi DNA polymerase (Kapa Biosystems KK2602). cDNA quality was assessed using High Sensitivity NGS Fragment Analyzer Kit (Advanced Analytical DNF-474) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 0.5 μg double strand fish sperm DNA (Roche, USA). Cold competitor probe was used as 125-fold molar excess or as indicated elsewhere ...
-
bioRxiv - Microbiology 2021Quote: DNA for use in the qPCR assay (LightCycler 96, Roche) was extracted using the GenElute Bacterial Genomic DNA kit (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... then complementary DNA was synthesized using a commercial kit (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 1x LightCycler® 1536 DNA Green mix (Roche 05573092001). qPCR reactions were performed using a LightCycler® 1536 Instrument (Roche 05334276001 ...
-
bioRxiv - Microbiology 2020Quote: ... dahliae Ls.17 (using the KAPA HiFi DNA polymerase, Roche) for complementing hex1 deletion strains ...
-
bioRxiv - Molecular Biology 2020Quote: ... together with 5 µl of a 1kB DNA Ladder (Roche). The electrophoresis was performed at 90 V constant.
-
bioRxiv - Microbiology 2021Quote: ... the DNA was hybridized with DIG Easy Hyb (Roche-11603558001) and detected with DIG wash and block buffer set (Roche-11585762001).
-
bioRxiv - Neuroscience 2020Quote: ... Digoxigenin (DIG)-labeled DNA molecular weight maker III (Roche #11218603910) was loaded as a marker ...
-
bioRxiv - Microbiology 2020Quote: ... and libraries prepared using a DNA KAPA library kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... quantitative PCR (qPCR) with FastStart Essential DNA Green Master (Roche) and a LightCycler96 (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA and cDNA was quantified on a Lightcycler 480 (Roche) as described (Gjidoda et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Linearized plasmid DNA was used to synthesize digoxigenin-UTP (Roche) labeled antisense probes with RNA polymerases from Promega and RNA probes were purified with Illustra ProbeQuant G-50 microcolumns (GE Healthcare) ...
-
bioRxiv - Genomics 2019Quote: ... and genomic DNA was removed with DNase I (Roche, 04716728001). First-strand cDNA was generated with the SuperScript III Fist-Stand using random hexamers ...
-
bioRxiv - Genomics 2021Quote: ... followed by amplification using KAPA HiFI DNA polymerase (KAPA Biosystems). 150 bp paired-end reads were generated on the Illumina NextSeq 500 according to the manufacturer’s standard sequencing protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA was degraded using DNase I (4716728001, Roche, Basel, Switzerland). RNA probes were then precipitated with LiCl and ethanol ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplification was conducted with Fast start DNA polymerase (Roche) or Platinium taq (Thermofisher).
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1X buffer and 0.625 unit of Taq DNA polymerase (Roche). The thermocycling profile consisted of 95°C for 5min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1 × buffer and 0.625 unit of Taq DNA polymerase (Roche).
-
bioRxiv - Immunology 2020Quote: ... Amplification of DNA was performed using the LightCycler 480 (Roche). Each sample was amplified in triplicate ...
-
bioRxiv - Genetics 2019Quote: ... LightCycler® 1536 DNA Probes Master (Roche, cat. nr. 05502381001), LightCycler® 480 High Resolution Melting Dye (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA was purified using High Pure PCR Purification Kit (Roche) and concentrations were quantified by Qubit (Thermo Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... and adapter ligation using the KAPA HyperPrep DNA kit (Roche). Each ligation product was index-amplified using unique dual 8-bp indexing primers for eight cycles with KAPA HiFi polymerase (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed using Kapa Taq DNA polymerase (Kapa Biosystems), under the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... using the FastStart Essential DNA Green Master Mix (Roche, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: DNA was amplified using Kapa-HiFi Hotstart (KK2502, Kapa Biosystems) using primers to 16S-V4 regions (V4-515F - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 µl of Fast STAR DNA SYBR Green reagents (Roche) and 0.5mM concentrations of primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... All PCRs were performed using Kapa HiFi DNA polymerase (Roche). Final constructs were partially sequenced using Sanger sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... with FastStart Essential DNA Green Master kit (Roche; Rotkreuz, Switzerland) with ~3 ng of cDNA and three technical replicates ...
-
bioRxiv - Genomics 2023Quote: ... The KAPA Library Quantification DNA Standards #1–5 (Roche #07960387001) were used for the standard curve ...
-
bioRxiv - Pathology 2023Quote: ... with FastStart Essential DNA Green Master Mix (Roche Life Science). All reactions were performed similarly ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Faststart Essential DNA master mix (Roche, Cat. No. 06924492001).
-
bioRxiv - Cell Biology 2022Quote: ... a DNA digestion was performed using DNAse I (#4716728001, Roche) to remove genomic DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... For ligations using the Rapid DNA Ligation Kit (Roche 11635379001) vector and insert were mixed in a 1:3 molar ratio ...
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were prepared using a KAPA HyperPlus kit (Roche). Briefly ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Complementary DNA was quantified by qPCR using Roche Lightcycler (Roche), as previously described [74] ...
-
bioRxiv - Immunology 2023Quote: ... we designed a custom Roche HyperCap DNA probe panel (Roche) that includes target sequences from the GRCh38 IGK proximal (chr2:88,758,000-89336429 ...
-
bioRxiv - Immunology 2023Quote: ... FastStart Essential DNA Green Master (Roche Life Science, Basel, Switzerland) in a LightCycler96 RT PCR system (Roche Life Science) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the KAPA hyper prep kit for DNA (now Roche). Truncated universal stub adapters were used for ligation ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA was obtained using Proteinase K (3115887001, Roche, Basel, Switzerland) digestion followed by phenol-chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA plasmids were transfected using X-tremeGENE HP (Roche Diagnostics) whereas siRNA was delivered using Lipofectamine™ RNAiMAX (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Microbiology 2024Quote: ... the Fast Start Essential DNA Green Master qPCR Kit (Roche), and a LightCycler 96 instrument (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... using the LightCycler FastStart DNA Master HybProbe kit (Roche Diagnostics) supplemented with SYBR Green ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies used for IFA were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:200) (Roche); mouse anti-PMV mAb (1:50) ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoblot with the anti-His-antibody conjugated to peroxidase (BMG-His-1 monoclonal antibody; Roche, Basel, Switzerland) was used to confirm the presence of enzymes.
-
bioRxiv - Cell Biology 2020Quote: The primary antibodies used in this study were as follows: mouse anti-HA antibody (Roche Life Science), mouse anti-PGK1 monoclonal antibody (Thermo Fisher/Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: Western blots were performed using the following antibodies: anti-myc antibody (Roche 0.4 mg/ml, 1/1000) followed by incubation with goat anti mouse HRP (BioRad 1/10000) ...