Labshake search
Citations for Roche :
51 - 100 of 10000+ citations for Testosterone ELISA Kit 1 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Other clinical urine markers were measured by using Combur10 Test®M semiquantitative test strips (Roche Diagnostics GmbH, Germany). Each test strip consists of colorimetric reaction spots for 10 markers ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the blood was collected directly on the test strips inserted in the glucometer (Accu-Chek® Performa, Roche, Germany). After blood collection ...
-
bioRxiv - Microbiology 2022Quote: ... bilirubin and occult blood) was measured by Cobas6500 urine dry chemical analysis system and supporting test strips (Roche, Switzerland). For the Coagulation indicators ...
-
bioRxiv - Immunology 2020Quote: ... Parasite cultures were confirmed to be free of mycoplasma and acholeplasma using an ELISA-based Mycoplasma Detection Kit (Roche) which contains polyclonal antibodies specific for M ...
-
bioRxiv - Neuroscience 2023Quote: ... in a 1:1 ratio and added to white 384 well plates (Roche). Plates were run on a 45-cycle protocol using the LC 480 II system (Roche).
-
bioRxiv - Microbiology 2019Quote: ... After washing with 1xPBS containing 0.1% v/v Tween-20, PIP–strips were incubated (1h, RT, agitated) with a monoclonal anti-HA antibody (clone 3F10, monoclonal antibody from Roche) at a dilution of 1:500 in blocking buffer ...
-
bioRxiv - Immunology 2021Quote: Mice were monitored for diabetes weekly by testing for glycosuria using colorimetric Diabur-Test 5000 strips (Roche, Boulogne-Billancourt, France). Overt diabetes was confirmed by testing for fasting glycemia >250 mg.dL-1 (Accu-Check ...
-
bioRxiv - Physiology 2023Quote: ... Blood glucose was determined using a commercial blood glucose meter and test strips (Accu-Chek Performa, Roche Diabetes Care, Inc) and after centrifugation plasma was snap frozen and stored at -80°C until further processing ...
-
bioRxiv - Immunology 2024Quote: ... A drop of blood from the nicked tail vein was used to determine the basal glucose concentration using AccuChec Instant test strips (C216796165-IMP, Roche) after six hours of fasting for GTT and without fasting for ITT ...
-
bioRxiv - Cancer Biology 2022Quote: The activity of telomerase in the cell lines was detected using the TeloTAGGG telomerase PCR ELISA Kit (Roche, Cat# 12013789001). The assay was performed according to the manufacturer’s instructions and repeated in triplicate ...
-
bioRxiv - Cell Biology 2020Quote: ... baseline glucose was measured in all animals using a drop of blood from a tail snip wound and Accu-check active glucometers and test strips (Roche Diagnostics). Then ...
-
bioRxiv - Biochemistry 2022Quote: An amount of 0.5 ml of whole blood taken from the lithium heparin bottle was used to analyse lactate levels using rapid Accutrend Plus diagnostic meter and BM Lactate test strips (Roche Diagnostics). Accutrend Plus diagnostic meter employs colorimetric lactate oxidase/mediator reaction and has a record of high reproducibility when compared with laboratory diagnosis.(12)
-
bioRxiv - Cancer Biology 2020Quote: Cell proliferation was measured by determining the extent of 5-Bromo-2’-deoxy-uridine (BrdU) incorporation into DNA of U87-MG cells using the BrdU cell proliferation assay ELISA kit (Roche, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Apoptosis was measured by Cell Death Detection ELISA (Roche). For reporter assays ...
-
bioRxiv - Cancer Biology 2024Quote: ... The beads were magnetically separated as above and pooled eluate added to PCR strip tubes containing 2X KAPA HiFi HotStart ReadyMix (Roche, Cat# 07958935001) and 2 mM each of P5 (AATGATACGGCGACCACCGAGATCTACA*C ...
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proliferative activities of VSMCs were quantified by BrdU incorporation using an enzyme-linked immunosorbent assay (ELISA) detecting kit (Roche, Mannheim, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... and CAT expression was quantified using the CAT ELISA (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking Reagent for ELISA (BRE) (11112589001) was manufactured by Roche. 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking reagent for ELISA (BRE, cat. 11112589001) was from Roche. DC Assay kit was from Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... at a 1:1 ratio in a 96-well deep-well extraction plate (Roche Diagnostics GmbH), covered with a MagNA Pure Sealing Foil (06241603001 ...
-
bioRxiv - Cancer Biology 2022Quote: Blood was sampled in mice by nicking the tail vein and blood glucose levels were measured using ACCU-CHEK Active test strips read by an ACCU-CHEK Active meter (Roche Diagnostics, Indianapolis, IN) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: Blood glucose measurements were collected with a glucometer (ACCU−CHEK Performa, USA) and the proper test strips (F. Hoffmann-La Roche AG, Basel, Switzerland). Blood lactate was also measured with the Lactate Pro 2 handheld device and respective test strips (AKRAY Europe B.V. ...
-
bioRxiv - Immunology 2023Quote: ... Plates were developed by addition of the 1-Step ABTS substrate (Roche). mAbs S30934 and mGO5335 were used as positive and negative controls ...
-
bioRxiv - Bioengineering 2021Quote: ... The blood glucose levels of ZDF rats in each group were measured using a digital glucose meter and test strips (Accu-Chek® Sensor, Roche Inc., Mannheim, Germany) 2 or 3 days prior to surgery and at the study endpoint ...
-
bioRxiv - Neuroscience 2021Quote: ... Glycemia was assessed with blood obtained at decapitation using a glucometer with reagent strips (ACCU-CHEK ® Aviva Nano; Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... A tail vein blood sample was applied on Accu-Chek® Performa Test strip (Cat# 06454038020) and glucose concentration was measured with Accu-Chek® Performa (Cat# 05894964014) blood glucose meter (both from Roche Diagnostics, Manheim, Germany).
-
bioRxiv - Microbiology 2022Quote: ... at a 1:1 ratio in a MagNA Pure 96-well deep-well extraction plate (06241603001, Roche), covered with a MagNA Pure Sealing Foil (06241638001 ...
-
bioRxiv - Cancer Biology 2019Quote: ... we used a cell death detection ELISA (Roche Molecular Systems, Inc.), which is an analytical quantitative sandwich enzyme immunoassay technique that uses the interaction the mouse monoclonal antibodies with DNA and histone to detect internucleosomal fragmented DNA ...
-
bioRxiv - Cell Biology 2019Quote: Cells proliferation was assessed by BrdU Cell proliferation ELISA from Roche. IL-6 ELISA was from Affimetrics ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was evaluated using a colorimetric Cell Proliferation ELISA (Roche), based on the measurement of the incorporation of bromodeoxyuridine (BrdU ...
-
bioRxiv - Biochemistry 2023Quote: Cell proliferation was determined using a colorimetric Cell Proliferation ELISA (Roche) kit ...
-
bioRxiv - Microbiology 2023Quote: ... using white LightCycler480 Multiwell Plate 96 plates (Roche). One 20 µl reaction contained 250 nM of hydrolysis probe ...
-
bioRxiv - Pathology 2019Quote: ... 60 min and 120 min after glucose treatment were examined using commercial blood glucose test strips (ACCU-CHEK®, Roche Diabetes Care GmbH, Shanghai, China). For insulin resistance detection ...
-
bioRxiv - Pathology 2020Quote: Fasting blood glucose was measured in blood samples from the tail vein using a glucometer and reactive strips (Accu-Chek® Performa, Roche LTDA. Jaguaré, SP, Brazil). Body weight ...
-
bioRxiv - Synthetic Biology 2022Quote: ... clear plates (Roche).
-
bioRxiv - Evolutionary Biology 2023Quote: ... The cell proliferation ELISA BrdU (5′-bromo-2′-deoxyuridine) colorimetric assay (Roche,11647229001) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and low-volume supernatants (90 μL media per well of a 48-well plate) were mixed 1:1 with 2× SDS/PAGE sample buffer containing Complete Mini EDTA-free Protease Inhibitor Mixture (Roche). In experiments where primary hMDMs were plated in a 24-well plate and infected with T4SS-Lp ...
-
bioRxiv - Cell Biology 2021Quote: ... The WST-1 kit was from Roche Diagnostics (Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... using SYBR Green 1 Master Kit (Roche). PCR amplification was performed as described (26) ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Cancer Biology 2022Quote: The BrdU assay was performed using the Cell Proliferation ELISA BrdU assay (Roche #11647229001) according to manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cellular proliferation was assessed with the BrdU cell proliferation ELISA (11647229001, Roche, Basel, Switzerland). In brief ...
-
The Polycomb group protein MEDEA controls cell proliferation and embryonic patterning in ArabidopsisbioRxiv - Developmental Biology 2020Quote: ... on 384-well plates (LightCycler 480 white plates and sealing foils, ROCHE), using 0.7μl of DNA per replicate and the SsoAdvanced Universal SYBR Green Supermix (BIORAD) ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Biochemistry 2019Quote: ... Blocking reagent for ELISA (BRE) and cOmplete protease inhibitor tablets were from Roche (Basel, Switzerland). Phosphate buffered saline (PBS ...
-
bioRxiv - Genomics 2021Quote: ... 100uL of the clarified supernatant was used in the anti-BrdU DNA fragmentation ELISA (Roche). Each condition was tested in technical triplicates ...
-
bioRxiv - Cell Biology 2022Quote: ... BrdU incorporation was carried out according to the manufacturer′s specifications (Cell Proliferation ELISA, Roche) with an incubation time of 5 hours as previously described.23 Quantification was performed by measuring the absorbance using Power Wave 340 ELISA reader from Bio-Tek.