Labshake search
Citations for Roche :
1 - 50 of 161 citations for TNF alpha TNFSF2 Human P.pastoris since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Microbiology 2020Quote: ... Pegylated interferon alpha-2a (PEG-IFN-α; Pegasys, 90 mcg, Roche) was aliquoted and stored at room temperature until further use ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Molecular Biology 2023Quote: ... DIG-labeled TER and alpha-tubulin probes were generated using the PCR DIG Probe Synthesis Kit (Roche) and used in the hybridization step (S1 Table ...
-
bioRxiv - Genomics 2024Quote: ... The probe was labeled with alpha-32P CTP using the High Prime DNA labeling kit (Roche, #11585584001). The labelled probe was purified on a G50 sephadex column (Cytiva ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Biophysics 2020Quote: ... fibronectin from human plasma (Roche), the final concentration used for the experiments was 50 μg/ml (containing 2/3 of bovine and 1/3 of human FN) ...
-
bioRxiv - Developmental Biology 2019Quote: ... human holotransferrin 0.6% (Roche, 10652202001); monothioglycerol 0.0039 % (Sigma ...
-
bioRxiv - Immunology 2019Quote: ... human recombinant IL-2 (Roche) was also added fresh immediately prior to use at a final concentration of 100 IU/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... Human fibronectin (Roche Diagnostics, 11051407001); Puromycin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and human insulin (11376497, Roche) were digested with recombinant WT or protease-dead (cf-E111Q ...
-
bioRxiv - Molecular Biology 2021Quote: Serum creatinine was determined using the creatininase/creatinase specific enzymatic method described by Bömer using a commercial kit (Alpha Laboratories Ltd. Eastleigh, UK) adapted for use on a Cobas Fara centrifugal analyser (Roche Diagnostics Ltd ...
-
bioRxiv - Molecular Biology 2021Quote: Serum albumin measurements were determined using a commercial serum albumin kit (Alpha Laboratories Ltd., Eastleigh, UK) adapted for use on Cobas Mira analyser (Roche Diagnostics Ltd ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 g/ml human transferrin (Roche), 5 ng/ml VEGF (PeproTech 450-32) ...
-
bioRxiv - Immunology 2022Quote: ... recombinant human IFNγ from Roche (#11040596001), recombinant human IL-1β from PeproTech (#200-01B).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 μg/ml human transferrin (Roche). Flk-1+ cells were isolated by magnetic cell sorting (MACS ...
-
bioRxiv - Molecular Biology 2021Quote: ... HCXII-0155) was incubated with neutrophils that were pre-treated with vehicle or DNase I (10U/ml, Dornase alpha, Roche, Germany) for 1h ...
-
bioRxiv - Immunology 2024Quote: ... the cells were quickly transferred into 10 ml of pre-warmed RPMI supplemented with 10% FBS and 100µg of Pulmozyme (dornase alpha, Roche, Basel, Switzerland) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... alpha synuclein and NfL) were measured in both cohorts using Elecsys assays in accordance with the manufacturer’s instructions (Roche Diagnostics International Ltd).52 CSF analyses were performed by technicians blinded to all clinical and imaging data ...
-
bioRxiv - Physiology 2019Quote: ... Serial dilutions of human genomic DNA (Roche) (final concentrations from 0.5 ng/mL to 5000 ng/mL ...
-
bioRxiv - Immunology 2021Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... Human IL-2 (TECIN™ teceleukin, ROCHE, was generously provided by the NCI Biological Resources Branch ...
-
bioRxiv - Molecular Biology 2021Quote: ... and human genomic DNA (Roche Diagnostics, Germany) were used as templates for the experiments in Figure 2 and S1a ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-CD20 human Ab (obinutuzumab, Roche). Relevant negative controls were performed using isotype antibodies and cells incubated with anti-CD20 human and anti-CD20 mouse antibody served as a positive control ...
-
bioRxiv - Immunology 2023Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: Total cell lysates from human RMS cell lines and human myoblasts were obtained following lysis in RIPA lysis buffer supplemented with protease inhibitors (Roche). Western blot analysis was performed similar to Ignatius et ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA from patients NL and BAR was analysed using a custom fine tiling array covering the alpha- and beta-globin gene clusters and surrounding areas was used (Roche NimbleGen, Madison, WI, USA). Array design was based on NCBI Build 36.1 (hg18 ...
-
bioRxiv - Biophysics 2019Quote: ... We employed fibronectin (FN, from human plasma, Roche Applied Science ...
-
bioRxiv - Neuroscience 2022Quote: ... The media for human NPCs obtained from Roche was supplemented with B-27-supplement minus vitamin A (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ng/ml recombinant human EGF (Roche, Ireland), 1 μg/ml hydrocortisone (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... human NEMO (5µg) and ATP (2mM) (Roche, 1051997900) were incubated in a reaction buffer consisting of 50mM HEPES (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... Human IFN-α2a (Roferon) was purchased from Roche. 2’-3’-cGAMP and c-di-UMP were purchased from Invivogen ...
-
bioRxiv - Genomics 2022Quote: ... 100 ng of human genomic DNA (11691112001, Roche) was tagmented in 25 μl reactions by adding 12.5 μl of 2X tagmentation buffer (20mM Tris-HCl pH 7.8 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Human gDNA of high molecular weight (Roche Diagnostics) and ssDNA (M13mp18 single-stranded virion DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.01 mg/mL human insulin (Roche, Indianapolis, IN, USA), 100 IU penicillin (Mediatech) ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... and human recombinant IL-2 (30 U/ml, Roche) for 72 h.
-
bioRxiv - Cancer Biology 2023Quote: ... human PR rabbit monoclonal antibody (Roche Diagnostics, 790-4296), and human Ki67 rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml recombinant human IL-2 (Roche). For activation of murine CD4+ T cells ...
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Immunology 2019Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The A20 cells were grown in RPMI-1640 (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).