Labshake search
Citations for Roche :
1 - 50 of 565 citations for TNF alpha Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Microbiology 2020Quote: ... Pegylated interferon alpha-2a (PEG-IFN-α; Pegasys, 90 mcg, Roche) was aliquoted and stored at room temperature until further use ...
-
bioRxiv - Molecular Biology 2023Quote: ... DIG-labeled TER and alpha-tubulin probes were generated using the PCR DIG Probe Synthesis Kit (Roche) and used in the hybridization step (S1 Table ...
-
bioRxiv - Genomics 2024Quote: ... The probe was labeled with alpha-32P CTP using the High Prime DNA labeling kit (Roche, #11585584001). The labelled probe was purified on a G50 sephadex column (Cytiva ...
-
bioRxiv - Molecular Biology 2021Quote: Serum creatinine was determined using the creatininase/creatinase specific enzymatic method described by Bömer using a commercial kit (Alpha Laboratories Ltd. Eastleigh, UK) adapted for use on a Cobas Fara centrifugal analyser (Roche Diagnostics Ltd ...
-
bioRxiv - Molecular Biology 2021Quote: Serum albumin measurements were determined using a commercial serum albumin kit (Alpha Laboratories Ltd., Eastleigh, UK) adapted for use on Cobas Mira analyser (Roche Diagnostics Ltd ...
-
bioRxiv - Molecular Biology 2021Quote: ... HCXII-0155) was incubated with neutrophils that were pre-treated with vehicle or DNase I (10U/ml, Dornase alpha, Roche, Germany) for 1h ...
-
bioRxiv - Immunology 2024Quote: ... the cells were quickly transferred into 10 ml of pre-warmed RPMI supplemented with 10% FBS and 100µg of Pulmozyme (dornase alpha, Roche, Basel, Switzerland) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... NeuroMab; HCN2: mouse, 75-111, NeuroMab; HCN3: mouse, 75-175, NeuroMab; HCN4: mouse, 75-150, NeuroMab; HA: mouse, 12CA5, Roche) in 1% milk powder and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... alpha synuclein and NfL) were measured in both cohorts using Elecsys assays in accordance with the manufacturer’s instructions (Roche Diagnostics International Ltd).52 CSF analyses were performed by technicians blinded to all clinical and imaging data ...
-
bioRxiv - Immunology 2021Quote: ... Mouse (Roche) on the LightCycler 2.0 (Roche) ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA from patients NL and BAR was analysed using a custom fine tiling array covering the alpha- and beta-globin gene clusters and surrounding areas was used (Roche NimbleGen, Madison, WI, USA). Array design was based on NCBI Build 36.1 (hg18 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFP (mouse, Roche, 11814460001 ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-GFP (Roche) (1:1000).
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-GFP (Roche), mouse anti-Ack1 (A-11 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche), anti-VSV-G 41A1 and rabbit anti-GM130 (clone EP892Y ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche) 1:2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP (Mouse, Roche, 11814460001), GST (Mouse ...
-
bioRxiv - Genetics 2022Quote: ... from mouse (Roche #11814460001) antibody and Anti-Mouse IgG −Alkaline Phosphatase antibody (A9316 ...
-
bioRxiv - Plant Biology 2020Quote: ... mouse anti-GFP (Roche) 1:2500 ...
-
Single-cell RNA sequencing reveals distinct tumor microenvironmental patterns in lung adenocarcinomabioRxiv - Cancer Biology 2020Quote: ... mouse anti-p16 (Roche, #805-4713 ...
-
bioRxiv - Cell Biology 2022Quote: α-GFP (Roche, from mouse) 1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-GFP (Mouse, Roche) (1/500) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:1,000 mouse αGFP (Roche) and 2° ...
-
bioRxiv - Developmental Biology 2020Quote: ... Antibodies: mouse α-GFP (Roche), rabbit α-RFP (Rockland) ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse BrdU (1:50; Roche), rat anti-LAMININ (1:100 ...
-
bioRxiv - Cell Biology 2019Quote: ... Mouse anti-GFP (Roche 11814460001) was diluted 1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-GFP (mouse, Roche, 11814460001), anti-GFP (goat ...
-
bioRxiv - Genomics 2019Quote: ... mouse anti-GFP antibody (Roche) and the HRP conjugated goat anti-mouse secondary antibody (Bangalore Genei) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-HA (12CA5, Roche); mouse anti-c-Myc (9E10 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-GFP antibodies (Roche) were used at a dilution of 1:1,000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-GFP (1814460, Roche), goat anti-IPO7 (PA518078 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFP mouse antibody (Roche #11814460001), KIF13A rabbit antibody (Thermo Fisher Scientific PA5-30874) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (11814460001, Roche), mouse anti-MMP1 (1:50 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Roche AB_390913), rabbit anti-CERT (Abcam ab151285).
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Roche 11814460001) 1:5000 for detecting Can1-GFP ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (11814460001, Roche), rabbit anti-GFP (A6455 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (11814460001, Roche), mouse anti-HA.11 (MMS-101R ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-GFP (Roche, product number 11814460001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-GFP (1814460, Roche), mouse anti-SUMO1 (18-2306 ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse Anti-GFP (Roche 11814460001) was used to specifically detect the transgenes ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-digoxigenin (#11333062910 -ROCHE) 1:125 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (#11814460001, Roche), mouse anti-tubulin (#3873 ...
-
bioRxiv - Neuroscience 2023Quote: ... and/or GFP (Roche, mouse) were used at 1:500 and 1:200 dilution ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... mouse anti-HA (12CA5, Roche) and rat anti-Tubulin (MCA78G ...
-
bioRxiv - Microbiology 2024Quote: ... anti-GFP (mouse, 11814460001, Roche). Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-GFP (mouse) (Roche, 11814460001) used at 1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Roche, # 11814460001) at 1:3000 ...