Labshake search
Citations for Roche :
1 - 50 of 276 citations for TNF alpha Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
Serine-ubiquitination regulates Golgi morphology and the secretory pathway upon Legionella infectionbioRxiv - Cell Biology 2020Quote: ... His (Roche), GRASP55 (Proteintech) ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Cell Biology 2022Quote: ... and His-tag (11965085001, Roche) antibodies were used to detect the proteins.
-
bioRxiv - Biochemistry 2019Quote: ... anti-His-tag (11922416001; Roche), anti-vinculin (V4505 ...
-
bioRxiv - Developmental Biology 2021Quote: ... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... cOmplete His-Tag Purification Resin (Roche) was added to the supernatant and samples were incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Either His (Thermo) or GFP (Roche) or GST (Santa Cruz ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoblot with the anti-His-antibody conjugated to peroxidase (BMG-His-1 monoclonal antibody; Roche, Basel, Switzerland) was used to confirm the presence of enzymes.
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatants containing the His-tagged histones were combined with NiNTA resin (Complete His-Tag purification Resin, Roche) (1mL of Ni-NTA per 1L of bacteria ...
-
bioRxiv - Plant Biology 2024Quote: ... and 1/5000 anti-His (11667475001, Roche) for GFP and His-Tag detection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 8G8-Fab were expressed with His-tag and purified using the cOmplete His-Tag purification resin (Roche, USA) following standard protocols ...
-
bioRxiv - Microbiology 2020Quote: ... Pegylated interferon alpha-2a (PEG-IFN-α; Pegasys, 90 mcg, Roche) was aliquoted and stored at room temperature until further use ...
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Biophysics 2020Quote: ... and amplified using KAPA Hi Fi polymerase (Roche) in 20 cycles of emulsion PCR35 (ePCR ...
-
bioRxiv - Biochemistry 2022Quote: ... purified by cOmplete His-Tag purification columns (Roche), and concentrated to 1 mg/mL using Amicon Ultra 10,000 NMWL (Merck) ...
-
bioRxiv - Microbiology 2020Quote: ... and cOmplete™ His-tag Purification Resin (Roche). Purity and glycosylation of recombinant proteins were examined by PNGase F (N-Zyme Scientifics ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cOmplete his-tag purification matrix from Roche is working equally well ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... Complete His-Tag Purification Resin (Roche, Basel, Switzerland), or Amylose Resin (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 12.5 μL of Kappa Hi Fi Hotstart ReadyMix (Roche) and each 0.75 μL (0.3 μM ...
-
bioRxiv - Biochemistry 2020Quote: ... and incubated with cOmplete His-Tag purification resin (Roche) for 16 hours on a tube roller (Starlab ...
-
bioRxiv - Cancer Biology 2021Quote: ... 12.5 μL of Kappa Hi Fi Hotstart ReadyMix (Roche) and each 0.75 μL (0.3 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... 12 µl of complete His-Tag Purification Resin (Roche) was added and incubated for 15 min at 25°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we used Kapa Hi-Fidelity Library Amplification Kits (Roche) in 20 µL reactions with 4µL Nextera Unique Dual Indexes Set A (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... or Complete His-Tag Purification Resin (Roche, Basel, Switzerland), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: Clarified supernatants were rocked with Complete His-Tag resin (Roche), 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Clarified lysates were loaded onto His-tag purification column (Roche) and the protein was eluted in a buffer containing 20 mM HEPES ...
-
bioRxiv - Biochemistry 2023Quote: ... and incubated with 4mL cOmplete His-Tag Purification Resin (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml of the cOmplete His-Tag purification resin (Roche) equilibrated with the Tris buffer 4 containing 25 mM Tris-HCl (pH 8.0 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and purified using cOmplete His-Tag Purification Resin (Roche, Switzerland) and His-Bind Purification kit (Novagen ...
-
bioRxiv - Genomics 2022Quote: ... and amplified using KAPA Hi-Fi Hotstart PCR kit (Roche, KK2602). After one more step of DNA cleanup ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KAPA Hi-Fi HotStart ReadyMix (KAPA Biosystems) and libraries were purified with AMPure XP magnetic beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2023Quote: ... The target protein was purified using His-Tag Purification Resin (Roche) according to the manufacturer instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Insert amplification was performed using the Kappa Hi Fi Hotstart ReadyMix (Roche). For a 25 μL reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... The cleared lysate was applied to cOmplete His-Tag purification resin (Roche), pre-equilibrated in lysis buffer and incubated at 4 °C for 6 h on a tube roller ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The recombinant biotinylated A33-His antigen was immobilized on streptavidin (StreptaWells, Roche) or avidin coated wells (Avidin ...
-
bioRxiv - Cancer Biology 2021Quote: ... Insert amplification was performed using the Kappa Hi Fi Hotstart ReadyMix (Roche). For a 25 μL reaction ...
-
bioRxiv - Genomics 2022Quote: ... DNA libraries were amplified with KAPA 2× Hi-Fi Hotstart Readymix (Roche) and purified with 18% Sera-Mag Magnetic Beads in polyethylene glycol.
-
bioRxiv - Microbiology 2020Quote: ... His-tagged CopS(34-151) was purified using Ni-NTA columns (Roche)(11) ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was filtered and incubated with His-tag purification resin (Roche) overnight at 4°C while mixing gently ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged ecMSG was loaded onto a gravity nickel affinity column (Roche) and eluted using 300 mM imidazole ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 or 2 mL of the cOmplete His-Tag purification resin (Roche) equilibrated with the solubilization buffer 2 was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... Hi-C libraries were prepared using KAPA LTP Library Preparation Kit (Roche) 65 with 12 amplification cycles ...
-
bioRxiv - Biochemistry 2023Quote: ... and applied to a 5 mL cOmplete His-tag purification column (Roche). The column was then washed with ∼100 mL of lysis buffer and bound proteins were eluted in 25 mL of lysis buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Cell Biology 2023Quote: ... Clarified lysate was loaded onto a cOmplete His-tag purification column (Roche), immobilized proteins washed with lysis buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and DNA libraries were amplified with KAPA 2X Hi-Fi Hotstart Readymix (Roche).
-
bioRxiv - Biophysics 2019Quote: ... the crude extracts mixed with cOmplete His-Tag purification resin (Roche, Basel, Switzerland) were loaded onto a polyprep chromatography column (Bio-Rad ...