Labshake search
Citations for Roche :
51 - 100 of 1007 citations for TGF beta 4 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... blocking was in 5% Horse Serum (X?) and 0.5% Western Blocking Reagent (Roche) MABTween solution and anti-DIG-POD was used ...
-
bioRxiv - Zoology 2020Quote: ... buds were incubated 45 mins in a blocking solution (Blocking Reagent (BR) (Roche) at 2% and saponine (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Chlorophenol red-beta-D-galactopyranoside (Roche Diagnostics, Indianapolis, IN) substrate was added to cell lysates ...
-
bioRxiv - Microbiology 2022Quote: ... Chlorophenol red-beta-D-galactopyranoside (Roche Diagnostics, Indianapolis, IN) substrate was added to cell lysates ...
-
bioRxiv - Developmental Biology 2021Quote: ... fixed with 0.2% gluteraldehyde/4% PFA at room temperature and incubated overnight in hybridization buffer (5% Dextran sulphate, 2% blocking powder from Roche, 5X SSC ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots were then incubated overnight at 4 °C with primary antibody of interest diluted in blocking solution (Western Blotting Reagent, Roche). The appropriate species of HRP-conjugated secondary antibody (from Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with blocking solution for 1 hour and finally incubated overnight at 4°C with anti-Fluorescein-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were blocked for 30 minutes in 1% Roche Western Blocking Reagent prior to incubating overnight at 4°C with either anti-FITC with horseradish peroxidase conjugate (Roche) at a 1:2000 concentration or anti-DIG-with horseradish peroxidase conjugate (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were blocked for 2 hours in blocking solution (1% blocking reagent; (Roche, 11096176001) in malic acid buffer (0.15M maleic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% blocking reagent (Roche, Germany)] containing 2.5 μg/mlCy-3-labelled telomere-specific (CCCTAA ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% Blocking reagent (Roche, 11096176001), 0.1% Tween 20 ...
-
bioRxiv - Neuroscience 2020Quote: ... using 2 % blocking reagent (Roche), followed by the detection of the Dig-labelled riboprobe with an anti-DIG Fab fragment conjugated with alkaline phosphatase (1:750 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% blocking reagent (Roche – 1096176001), 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910 ...
-
bioRxiv - Physiology 2022Quote: ... 0.25% Blocking Reagent (Roche 11096176001), and 0.5μg/ml Telomeric PNA-Cy3 probe (Panagene)-were added to each slide ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in PBSTr and incubated overnight at 4 °C MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-Fluorescein-POD Fab fragments serum (1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated overnight at 4°C in 0.1M malic acid/0.1%-TritonX (MABTr)/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-AP Fab fragments serum (1:5000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were incubated overnight at 4 °C in blocking solution MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-POD Fab fragments serum (1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% Blocking reagent (Roche 11096176001) and 10 mM Tris ...
-
bioRxiv - Physiology 2022Quote: ... 1.98% Blocking Reagent (11096176001, Roche), 49.5% formamide ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% blocking reagent (Roche, 11096176001), 1% bovine serum albumin (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5% blocking solution (Roche)] containing 100nM telomeric PNA probe TelC-FITC (F1009 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 2% blocking reagent (Roche, #11096176001), 10% heat-inactivated sheep serum (Equitech-Bio ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5% blocking solution (Roche)] containing 100nM telomeric PNA probe TelC-FITC (F1009 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% blocking reagent (Roche #11096176001) in MABT at room temperature for 30 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% beta-mercaptoethanol and protease and phosphatase inhibitors (Roche Complete Mini protease inhibitor ...
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... After blocking for 1-2h with the 1% blocking reagent (Roche Applied Science, cat# 10057177103), sections were incubated with alkaline phosphatase-conjugated anti-DIG antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pH 7.5) and blocked in MABT blocking buffer [MABT containing 1% blocking reagent (Roche #11096176001)] with 10% sheep serum for 2,5 hours at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... pH 7.5) and blocked in MABT blocking buffer [MABT containing 1% blocking reagent (Roche #11096176001)] with 10% sheep serum for 2.5 hours at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunostaining was performed after FISH development by re-blocking planarians in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx) for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were incubated in ISH blocking buffer (10% lamb serum 0.2% Roche blocking reagent in TBS) for 1 hour at room temperature and then incubated overnight at 4°C in HRP-conjugated anti-DIG or anti-FL antibodies (in key resource table) ...
-
bioRxiv - Neuroscience 2022Quote: ... Following 1 hour incubation in blocking buffer (10% lamb serum, 0.2% Roche blocking reagent in TBS), the slides were incubated overnight at 4°C in HRP-conjugated anti-DIG or anti-FL antibodies ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... Embryos were incubated overnight at 4 °C in blocking solution supplemented with the alkaline phosphatase coupled anti-digoxigenin antibody (Roche, REF 11093274910) 1:3000 ...
-
bioRxiv - Cell Biology 2019Quote: ... blocked with blocking reagent (Roche/Merk) and incubated with anti-DIG antibody conjugated with alkaline phosphatase (AP) ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 1xWestern Blocking Reagent (Roche) and labeled for IF imaging ...
-
bioRxiv - Developmental Biology 2021Quote: ... incubated in blocking solution (Sigma Roche) for 1 hour at room temperature before incubation with anti-DIG antibody (1:4000-5000 in blocking solution) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and blocked using Blocking Reagent (Roche). DIG-labeled probes were detected using mouse monoclonal anti-DIG primary antibody (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... in 0.5% blocking reagent (Roche, 11096176001), in PBT at 4°C.
-
bioRxiv - Neuroscience 2021Quote: ... in 0.5% blocking reagent (Roche, 11096176001) for 24 h ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...