Labshake search
Citations for Roche :
201 - 250 of 598 citations for Recombinant Rat Tnfsf15 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 1:1000 rat anti-HA-Peroxidase (Roche, 12013819001) and 1:1000 rabbit anti-V5 (Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... rat monoclonal (clone 3F10, Roche #11867423001, 1:500); anti-puromycin ...
-
bioRxiv - Neuroscience 2023Quote: ... and rat anti-HA (1:100; Roche, Switzerland) (2 ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal rat anti-HA antibody (Roche, Basel, Switzerland) and mouse anti-GFP antibody (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... HA (1:100, rat, Roche #11-867-423), and GFP (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat anti-HA (Roche Cat.#: 1186742300; 1:100), rabbit anti-mouse caspase-3 (R+D systems Cat.# ...
-
bioRxiv - Cell Biology 2023Quote: ... rat a-HA (clone 3F10; Roche Applied Sciences), mouse a-Centrin (clone 20H5 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-HA (Roche, 3F10, IF 1:500); rabbit monoclonal anti-tetherin (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-HA 1:100 (Roche Cat # 3F10), rabbit anti-Vasa 1:10,000 (R ...
-
bioRxiv - Biochemistry 2023Quote: ... and anti-HA antibody (made in rat; Roche) were used to detect the his-tagged and HA-tagged proteins on western blot ...
-
bioRxiv - Plant Biology 2023Quote: ... α- HA(rat)-1:2000 (Roche Diagnostics, Basel, Switzerland), α-UGPase(rabbit)-1:2,000 (Agrisera ...
-
bioRxiv - Neuroscience 2023Quote: ... rat antibody to HA (3F10, 1:50, Roche), rat antibody to Myc (4A6 ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat anti-HA (3F10; Roche Applied Science; RRID:AB_2314622), mouse anti-V5 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Primary antibodies were rat anti-HA (3F10, Roche) (1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... HA-tagged proteins were detected and visualized using an HA antibody conjugated to HRP (Roche). For anti-HA immunoprecipitations ...
-
bioRxiv - Plant Biology 2021Quote: ... HA and GFP-tagged fusion proteins were detected using a Peroxidase-conjugated α-HA (Roche) or α-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged proteins were detected using mouse anti-GFP antibody (Roche 1814460, 1:1000 dilution) and anti-mouse-HRP antibody (Amersham ...
-
bioRxiv - Plant Biology 2022Quote: ... HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche) and anti-FLAG M2 (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.
-
bioRxiv - Microbiology 2020Quote: ... and incubated overnight with rat anti-HA tag (Roche) and mouse anti-Actin (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Slides were incubated with primary rat anti-HA (Roche) at 1:100 and primary mouse anti-PfEMP1 ATS at 1:500 overnight ...
-
bioRxiv - Biophysics 2021Quote: ... Primary antibodies were: rat-anti-HA (1:5,000; Roche Applied Science catalog ...
-
bioRxiv - Neuroscience 2021Quote: ... rat monoclonal anti-HA (Roche, clone 3F10, 1:1,000), and guinea pig polyclonal anti-PSD-95 (Frontier Institute ...
-
bioRxiv - Developmental Biology 2020Quote: ... rat anti-HA 1:100 (ROAHAHA Clone 3F10, Roche); rabbit anti-HA 1:800 (C29F4 #3724 ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:500 Rat anti-HA (Roche Diagnostics, Indianapolis, IN), 1:500 Rat anti-C-Myc (BioRad ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies: rat anti-HA (Roche 11867431001, 1:500), mouse anti-HA (Biolegend 901501 ...
-
bioRxiv - Neuroscience 2021Quote: ... rat anti-HA at 1μg/mL (Roche clone 3F10), and mouse anti-PDF at 0.3μg/mL (Developmental Studies Hybridoma Bank c7-c) ...
-
bioRxiv - Plant Biology 2021Quote: ... rat α-HA (1:250, Roche, #11867423001, Indianapolis, IN) or Rabbit α-GFP polyclonal (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:1000 for anti-HA (rat mAb, 3F10, Roche), anti-flag (mouse mAb ...
-
bioRxiv - Cell Biology 2019Quote: ... HA for XPB staining (1/200, rat, Roche 3F10), TBP (1/200 ...
-
Supra-molecular assemblies of ORAI1 at rest precede local accumulation into punctae after activationbioRxiv - Biophysics 2020Quote: ... high affinity (3F10) from rat IgG1 was from Roche Diagnostics ...
-
bioRxiv - Microbiology 2020Quote: ... and rat anti-HA at 1:1000 (Roche, 11867423001). After washing ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (3F10; Roche Diagnostics, 1:1,000 dilution), mouse antiConnectin [C1.427 ...
-
bioRxiv - Microbiology 2021Quote: ... Rat anti-HA (Clone 3F10) was purchased from Roche. Rabbit anti-TgSAG1 antibodies was provided by John Boothroyd ...
-
bioRxiv - Molecular Biology 2022Quote: ... rat-anti-HA (1:1000 for IB; Roche, ROAHAHA), rabbit anti-RECQL5 (1:1000 for IB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and monoclonal rat anti-HA antibody (Roche; Basel, CH).
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HA (rat monoclonal 3F10, Roche #11867431001, 1:5000), anti-TFR (monoclonal H68.4 ...
-
bioRxiv - Pathology 2023Quote: ... Rat anti-HA (3F10, 1:5000; Roche, Mannheim, Germany), mouse anti-myc (9B11 ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... The primary antibodies used: rat anti-HA (3F10, Roche), mouse anti-HA (12CA5 ...