Labshake search
Citations for Roche :
401 - 450 of 1191 citations for Recombinant Rat Fc Fragment Of LgG Low Affinity IIb Receptor CD32 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 µL of the Ni-NTA slurry (Roche cOmplete His-Tag purification resin) was washed with 2x1 mL of wash buffer (WB ...
-
bioRxiv - Molecular Biology 2023Quote: ... After gap repair with Kapa Hi-Fi HotStart Uracil+ DNA Polymerase (KAPA Biosystems) and Taq DNA Ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the supernatant was loaded into cOmplete™ His-Tag Purification Resin (Roche) pre-equilibrated with wash buffer ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... or zebrafish genomic DNA using the Expand Hi-Fidelity PCR System (11732641001, Roche). Exact coordinates are listed in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants after high-speed centrifugation were loaded onto His-Tag Purific Resin (Roche), washed and eluted with 50 mM Tris.HCl pH 7.5 ...
-
bioRxiv - Genomics 2024Quote: ... The cleared lysate was loaded onto a cOmplete His-tag purification column (Roche) and the His6-Sumo3-Tn5 was eluted with a running buffer containing 300 mM imidazole ...
-
bioRxiv - Developmental Biology 2019Quote: ... The precleaned lysates were incubated with 1 µg Anti-HA high-Affinity (3F10, Roche) or normal IgG (GE healthcare ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... HA-tagged proteins were detected and visualized using an HA antibody conjugated to HRP (Roche). For anti-HA immunoprecipitations ...
-
bioRxiv - Plant Biology 2021Quote: ... HA and GFP-tagged fusion proteins were detected using a Peroxidase-conjugated α-HA (Roche) or α-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged proteins were detected using mouse anti-GFP antibody (Roche 1814460, 1:1000 dilution) and anti-mouse-HRP antibody (Amersham ...
-
bioRxiv - Plant Biology 2022Quote: ... HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche) and anti-FLAG M2 (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti-Digoxigenin-AP Fab fragments (Roche Applied Science, Indianapolis, IN) was incubated in antibody block overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... One unit of Anti-Digoxigenin-AP Fab fragments (Roche, 11093274910) was added to the blocking solution and incubated for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche #11093274910, RRID:AB_514497) were freshly added to the blocking buffer at 1:10,000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... It was followed by flushing anti-digoxigenin Fab fragments (Roche) in the channel to create covalent bonds with NHS group on PEG and incubated for another 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-Digoxigenin-AP Fab fragments (Cat # 11093274910, Roche, Basel, Switzerland) were diluted 1:800 in Antibody Dilutant Solution (Table 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were incubated in anti-digoxigenin Fab fragments (Roche) at 1:5000 in TBST overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... and anti-DIG antibody (Anti-Digoxigenin-AP Fab fragments; Roche), before washing and visualisation ...
-
bioRxiv - Developmental Biology 2022Quote: ... The anti-digoxigenin-POD Fab fragment antibody (Roche, REF 11207733910) was used 1:400 in blocking solution and embryos were incubated overnight at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: Biotinylated anti-HA fab fragments were purchased from Roche (#12158167001), and EGF biotinylated at a 1:1 stoichiometry was purchased from Life Technologies (# E- 3477) ...
-
bioRxiv - Bioengineering 2023Quote: ... After the reaction with anti-digoxigenin-AP Fab fragments (Roche), the bands were detected by enhanced chemiluminescence using CDP-Star (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) and incubated for 1 h at room temperature or 2 h at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) or Ni Sepharose High Performance (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... Fab was purified from cell culture supernatant by cOmplete His-Tag Purification Resin (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... His6-GFP and His6-mCherry proteins were purified with cOmplete His tag resin (Roche) according to the manufacturers protocols as previously described9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was added to cOmplete His-Tag Purification Resin (Merck Millipore/Roche) and incubated at 4°C for 1.5 h ...
-
bioRxiv - Genomics 2024Quote: ... the dialyzed sample was loaded again onto a cOmplete His-tag purification column (Roche), and the untagged Tn5 was collected in the flow-through ...
-
bioRxiv - Microbiology 2020Quote: ... Then concentrated supernatant was purified by immobilized metal-affinity chromatography with Ni-NTA resin (Roche) stocked in WET FRED gravity flow columns (IBA ...
-
bioRxiv - Bioengineering 2022Quote: ... S195A-GD-FXa protein was further purified on an anti-Protein C Affinity matrix (Roche). Maldi mass spectrometry showed that TFPI was glycosylated ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3h at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.
-
bioRxiv - Microbiology 2020Quote: ... and incubated overnight with rat anti-HA tag (Roche) and mouse anti-Actin (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Slides were incubated with primary rat anti-HA (Roche) at 1:100 and primary mouse anti-PfEMP1 ATS at 1:500 overnight ...
-
bioRxiv - Biophysics 2021Quote: ... Primary antibodies were: rat-anti-HA (1:5,000; Roche Applied Science catalog ...
-
bioRxiv - Neuroscience 2021Quote: ... rat monoclonal anti-HA (Roche, clone 3F10, 1:1,000), and guinea pig polyclonal anti-PSD-95 (Frontier Institute ...
-
bioRxiv - Developmental Biology 2020Quote: ... rat anti-HA 1:100 (ROAHAHA Clone 3F10, Roche); rabbit anti-HA 1:800 (C29F4 #3724 ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:500 Rat anti-HA (Roche Diagnostics, Indianapolis, IN), 1:500 Rat anti-C-Myc (BioRad ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies: rat anti-HA (Roche 11867431001, 1:500), mouse anti-HA (Biolegend 901501 ...