Labshake search
Citations for Roche :
1 - 50 of 714 citations for Recombinant Mouse Tnf None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Genetics 2022Quote: ... MYC-tagged or FLAG-tagged recombinant proteins were captured using ~5μg antibody and Protein-Agarose beads (Roche Applied Science, 11243233001) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected with mouse (Covance) or rat (Roche) monoclonal anti-V5 antibodies at 1 μg/ml or 12.5 ng/ml respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged proteins were detected with a mouse anti-FLAG (Roche) antibody diluted 1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal mouse antibodies were used to detect GFP-tagged proteins (Roche) (dilution 1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected with a mouse anti-GFP antibody (1:5000; Roche). Immunoblot results were quantified using Image J software (v1.8.0).
-
bioRxiv - Biochemistry 2020Quote: ... GFP-tagged proteins were detected with a primary mouse antibody IgG1K Anti-GFP (Roche) diluted to 1:1000 in 5 % (w/v ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged proteins were detected using mouse anti-GFP antibody (Roche 1814460, 1:1000 dilution) and anti-mouse-HRP antibody (Amersham ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2019Quote: ... hybridized fluorescein tagged dUTP was detected with alkaline phosphatase tagged anti fluorescein Fab fragments (Roche), revealed with CDP-Star (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... eGFP-tagged readthrough reporter was immunoprecipitated by addition of 10 μg of mouse monoclonal anti-GFP IgG (Roche, cat#11814460001) or normal mouse IgG as a negative control (Proteintech ...
-
bioRxiv - Immunology 2019Quote: ... human recombinant IL-2 (Roche) was also added fresh immediately prior to use at a final concentration of 100 IU/ml ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant HBsAg (Roche Diagnostics International) was used as a marker for aerosol formation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with recombinant DNase I (Roche) treatment ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and recombinant proteinase K (Roche). Samples were run on a 1% certified megabase agarose (Bio-Rad ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... and GFP- tagged pCREB3L3 using X-tremeGENE 9 (Roche). Cells were grown on coverslips ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Immunology 2022Quote: ... recombinant human IFNγ from Roche (#11040596001), recombinant human IL-1β from PeproTech (#200-01B).
-
bioRxiv - Microbiology 2021Quote: ... Recombinant IFN-α2a (Roferon L03AB04, Roche) and IFN-λ1 (Peprotech 300-02L ...
-
bioRxiv - Neuroscience 2022Quote: ... tagged cDNA synthesized using the KAPA mRNA HyperPrep kit (Roche). The prepared libraries were sequenced on an Illumina NextSeq 500 using High Output Flowcell Cartridge from the NextSeq 500/550 Output v2 kit (75 cycles ...
-
bioRxiv - Immunology 2022Quote: ... DNAse I recombinant (Roche by Sigma Aldrich) and sodium pyruvate (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Immunology 2023Quote: ... 100 units/mL recombinant IL-2 (Roche), and 5 μg/mL PHA (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: 20,000 endogenously tagged HEK293T cells were grown on a fibronectin (Roche)-coated 96-well glass bottom plate (Cellvis ...
-
bioRxiv - Plant Biology 2021Quote: ... HA-tagged proteins were detected with Anti-HA-Peroxidase (Roche #12013819001) at a dilution of 1:5,000 ...
-
bioRxiv - Genetics 2019Quote: ... The GFP-tagged proteins were probed with anti-GFP antibody (Roche) (1:1,000 ...
-
bioRxiv - Genetics 2021Quote: ... plus 1µI of alkaline phosphatase tagged anti-fluorescein F(ab) (Roche), followed by four washes at RT in 100 mM Tris pH7.55 ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative Western blot analysis was employed to determine concentration of recombinant protein using a recombinant GFP standard (Roche, 11814524001) with a defined concentration of 1 mg/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected with Anti-c-myc-Peroxidase (Roche #11814150001) at dilution of 1:5,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected using 1:1,000 anti-HA antibody (Roche) and 1:5,000 anti-rat antibody (Abcam) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Labelling and detection used random prime labelling incorporating fluorescein tagged dUTP (Roche). Following probing ...
-
bioRxiv - Microbiology 2020Quote: ... His-tagged CopS(34-151) was purified using Ni-NTA columns (Roche)(11) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged ecMSG was loaded onto a gravity nickel affinity column (Roche) and eluted using 300 mM imidazole ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 10 ng/ml recombinant human EGF (Roche, Ireland), 1 μg/ml hydrocortisone (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of tagged constructs was done using: HA-peroxidase antibody (Roche, ref: 12013819001), anti- TAP antibody (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... GFP- or HA3x-tagged proteins were detected using α-GFP (1:1000; Roche) or α-HA3x (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with recombinant DNASE I (1000 U) (Roche, 0453628001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by the treatment with recombinant DNase I (Roche). 1 µg of the obtained RNA was used for cDNA synthesis using Superscript III (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin-2 (20U/ml; Hoffmann-La Roche). Fresh medium containing IL-2 was added twice per week ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... and human recombinant IL-2 (30 U/ml, Roche) for 72 h.