Labshake search
Citations for Roche :
301 - 350 of 1351 citations for Recombinant Mouse Regenerating Islet derived 3 Alpha His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: HA-tagged constructs for western blotting were detected using a 1:5000 dilution of anti-HA-peroxidase antibody (Roche clone 3F10, #12013819001). HA-tagged constructs for indirect immunofluorescence were detected using anti-HA (Zymed ...
-
bioRxiv - Neuroscience 2019Quote: ... Clear supernatant was incubated with 2 ml of pre-equilibrated Ni-beads (cOmplete™ His-Tag Purification Resin, Roche, Switzerland) for 1 h and then transferred to a sigma column to be washed consecutively with His-binding buffer (50 mM HEPES pH 8.0 ...
-
bioRxiv - Plant Biology 2021Quote: ... and the presence of SnASFF1-HT was confirmed by immunoblot using the BMG–His-1 monoclonal antibody (Roche, Basel, Switzerland). Purified SnASFF1 proteins were stored in 100 mM sodium acetate (pH 4.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... The clarified supernatant was filtered through a 0.45 μM cartridge filter and incubated with 10 mL of cOmplete His- Tag purification beads (Roche, Germany) for 45 min ...
-
bioRxiv - Molecular Biology 2020Quote: 50 million cell pellets were resuspended in 2.5ml ice cold Hi-C Lysis Buffer (10mM Tris HCl, 10mM NaCl, 0.2% NP-40, 1X protease inhibitors (Roche, 04693124001)) and split into 10 million cell amounts ...
-
bioRxiv - Biophysics 2022Quote: ... The recombinant human Sox6 HMG domain was purified from supernatant of bacterial lysate by using NiNTA resin (Complete His-Tag purification Resin, Roche) and followed by SP sepharose column chromatography (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... His – tagged SARS-CoV2 S trimers were purified using a two-step purification protocol by 1 mL or 5mL cOmplete His-tag columns (Roche). Proteins were further purified by size-exclusion chromatography using a HiLoad Superdex 200 16/600column (GE Healthcare).
-
bioRxiv - Neuroscience 2019Quote: ... Harvested cells were washed once with PBS and resuspended in His-Trap binding buffer (50 mM Tris, pH 8; 150 mM NaCl; 20 mM imidazole; protease inhibitor cocktail (Roche) and 50 μM NBQX to displace glutamate and promote dimerization) ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was then processed by immobilized metal affinity chromatography (IMAC) on a gravity column containing 2 mL bed volume of cOmplete His Tag purification resin (Roche). After loading the lysate ...
-
bioRxiv - Immunology 2022Quote: The protein of interest was captured from the clarified conditioned medium by IMAC using a cOmplete His-Tag purification column (Roche) and further purified by SEC using preparative grade HiLoad 16/600 Superdex 75 columns (Cytiva ...
-
bioRxiv - Biochemistry 2023Quote: ... SUPREM variants were purified by affinity chromatography in an open column using cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland), eluting with 20 mM HEPES pH 7.0 ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was loaded on a column filled with cOmplete His-tag Purification Resin (Roche Diagnostics GmbH, Mannheim, Germany) and pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Evolutionary Biology 2019Quote: 15-20 µg of total RNA was digested with DNase I (recombinant, RNase-free, Roche Life Science) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... The resulting lysate was cleared by centrifugation (13 000 g, 40 min, 4°C) and the supernatant was incubated with cOmplete His-tag purification resin (Roche, Germany) and allowed to bind overnight at 4°C with gentle agitation ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-GFP (Roche) (1:1000).
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-GFP (Roche), mouse anti-Ack1 (A-11 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche), anti-VSV-G 41A1 and rabbit anti-GM130 (clone EP892Y ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche) 1:2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP (Mouse, Roche, 11814460001), GST (Mouse ...
-
bioRxiv - Genetics 2022Quote: ... from mouse (Roche #11814460001) antibody and Anti-Mouse IgG −Alkaline Phosphatase antibody (A9316 ...
-
bioRxiv - Plant Biology 2020Quote: ... mouse anti-GFP (Roche) 1:2500 ...
-
Single-cell RNA sequencing reveals distinct tumor microenvironmental patterns in lung adenocarcinomabioRxiv - Cancer Biology 2020Quote: ... mouse anti-p16 (Roche, #805-4713 ...
-
bioRxiv - Cell Biology 2022Quote: α-GFP (Roche, from mouse) 1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-GFP (Mouse, Roche) (1/500) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mg of nuclear extract of KDM3A and KDM3B endogenously tagged ESCs (prepared as above) was incubated with 10 µg of HA antibody (Roche, clone 12ca5, catalog#11583816001) for 4 hours rotating at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...