Labshake search
Citations for Roche :
51 - 100 of 713 citations for Recombinant Mouse Ngf None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Microbiology 2019Quote: ... GRA16HA (and other HA-tagged proteins) was detected using rat anti-HA antibodies (Roche) while GRA24MYC was detected using rabbit anti-MYC tag antibody 9E10 (Santa Cruz Biotechnology) ...
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation (IP) of HA-tagged proteins was performed using Anti-HA Affinity matrix (Roche) under denaturing conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunoprecipitation of GFP/YFP-tagged proteins was performed with anti-GFP antibodies (11814460001, Roche) using a method we previously described (Ishii and Akiyoshi ...
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... HA-tagged proteins were detected and visualized using an HA antibody conjugated to HRP (Roche). For anti-HA immunoprecipitations ...
-
bioRxiv - Plant Biology 2021Quote: ... HA and GFP-tagged fusion proteins were detected using a Peroxidase-conjugated α-HA (Roche) or α-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Plant Biology 2022Quote: ... HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche) and anti-FLAG M2 (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The recombinant biotinylated A33-His antigen was immobilized on streptavidin (StreptaWells, Roche) or avidin coated wells (Avidin ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Systems Biology 2021Quote: Recombinant proteins were purified using the Anti-Protein C Affinity Matrix (11815024001, Roche) on an ASPEC liquid handling instrument (Gilson) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The extracted RNA was then treated with DNase I recombinant RNase free (Roche) and the reverse transcription was done using the Super-Script IV (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 200 U/ml of recombinant human IL-2 (Roche, Nutley NJ, USA). All cell lines were grown in cell culture incubators at 37°C in the presence of 5% CO2.
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μg of total RNA was incubated with recombinant DNase I (Roche, 04716728001) for 30 min at 37°C and the reaction was stopped by incubation at 75°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Residual genomic DNA contamination was removed by treatment with recombinant DNAse I (Roche). cDNA was generated using Superscript II reverse transcriptase and Oligo d(T ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant lentiviruses were produced by transfecting HEK293T cells using FuGENE®6 (Roche) with plasmids encoding viral enzymes and envelope proteins essential for packing of viral particles (pRSV-EV ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Microbiology 2023Quote: DNase treatment was performed using recombinant RNase-free DNase I (Roche, Basel, Switzerland) according to the manufacturer’s protocols for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... 1X antibiotic-antimycotic) with 100 U/mL recombinant interleukin (IL)-2 (Roche #11147528001) and activated or frozen in freezing media (90% FBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... His-tagged AtTPL188 (wt and mutants) bacteria pellets were resuspended in buffer A with EDTA-free antiprotease (Roche). The soluble fractions recovered after sonication were passed through a Ni-sepharose (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatants containing the His-tagged histones were combined with NiNTA resin (Complete His-Tag purification Resin, Roche) (1mL of Ni-NTA per 1L of bacteria ...
-
bioRxiv - Cancer Biology 2023Quote: ... The His-tagged-TRF2TRFH protein was purified in presence of cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) by using Protino ® Ni-TED 2000 Packed Columns (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2023Quote: ... HA-and GFP-tagged proteins were detected using horseradish peroxidase–conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was extracted from recombinant clones with the High Pure Isolation kit (Roche) as directed by the manufacturer and sequenced in an ABI PRISM 3100 genetic analyzer (Applied Biosystem ...