Labshake search
Citations for Roche :
551 - 600 of 1666 citations for Recombinant Mouse Cd79a protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Protein G agarose beads (Roche #11719416001) pre-blocked with salmon sperm (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... together with protein A agarose (Roche) overnight at 4 ℃ ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein G agarose beads (11243233001, Roche) were added to the lysates and incubated for additional 4 hours at 4°C with rotary agitation ...
-
bioRxiv - Neuroscience 2021Quote: ... homogeneous protein G-agarose suspension (Roche) was added to the suspension ...
-
bioRxiv - Microbiology 2019Quote: ... Protein G-conjugated agarose beads (Roche) or PrecipHen for chicken antibodies (Aves Labs ...
-
bioRxiv - Cell Biology 2019Quote: ... protein inhibitor cocktail (Roche, Mannheim, Germany) and then sonicated ...
-
bioRxiv - Genetics 2021Quote: ... proteins were digested with LysC (Roche, Basel ...
-
bioRxiv - Developmental Biology 2022Quote: ... proteins were digested with LysC (Roche, Basel ...
-
bioRxiv - Developmental Biology 2023Quote: ... proteins were digested with LysC (Roche, Basel ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Protein G-Agarose (Roche, 11243233001) were added to each sample and incubated for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... proteins were digested with LysC (Roche, Basel ...
-
bioRxiv - Immunology 2022Quote: ... colon tissue was homogenised in 350 µl of lysis buffer (40 ml of PBS, 10%FCS, 2 Complete Protease Cocktail Inhibitor Tablets (Roche, Mannheim, Germany). Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... Antisense DigoxigeninUTP-labeled RNA probes were synthesized at 37°C using RNA DIG labeling mix per manufacturer’s instructions (Roche) using RNA polymerase ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dig-labeled sense and antisense RNA probes for vasa were prepared as described previously [24] (Ambion AM1310, Roche 11277073910). Probes were diluted to 2ng/μL in 100% hybridization solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Developmental Biology 2019Quote: ... The digoxigenin-labeled RNA probes were prepared using a DIG RNA labeling kit according to the manufacturer’s protocol (Roche) using each cDNA clone as the template ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1X Denhardt solution) containing 1μg/ml DIG labeled RNA probes (prepared with a DIG RNA labeling mix, Roche, 11277073910) for overnight at 65°C in a humid chamber ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were purified by precipitation and one microgram each was labeled by nick translation (Invitrogen or Roche Diagnostics) with Cy3-dUTP (GE ...
-
bioRxiv - Cell Biology 2022Quote: ... The labeled cells were directly harvested in 1ml of RIPA buffer including 1X EDTA-free protease inhibitor cocktail (Roche). The lysate was cleared by centrifugation at 20,000g for 15 min ...
-
bioRxiv - Genomics 2022Quote: ... The BAC clone (MSMg01-38O12) was labeled by nick-translation with biotin-16-dUTP (Cat# 11093070910, Roche Applied Science) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIG-labeled probes where generated using T7/SP6 transcriptions start sites and the digoxigenin RNA Labeling Mix kit (Roche) after manufactures instructions ...
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sense and antisense riboprobes were transcribed from linearized plasmids and labeled with digoxigenin (DIG RNA-labelling reagents, Roche Biochemicals). Primers used to amplify zebrafish nhsb were 5’ tgatctaccttttctcccatgccatt 3’ and 5’ tctcacacaccacagaggctcca 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense and sense digoxogenin (DIG)-labeled RNA probes were generated using the DIG RNA labeling kit (Roche Diagnostics, Germany), following the manufacturer’s instructions ...
-
Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafishbioRxiv - Developmental Biology 2022Quote: ... The probes labeled by digoxigenin were detected using alkaline phosphatase coupled anti-digoxigenin Fab fragment antibody (Roche, Basel, Switzerland) with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories ...
-
bioRxiv - Genetics 2023Quote: ... The antisense probe for wdr31 was then transcribed with digoxigenin-labeled UTPs and T7 RNA polymerases (Roche, Basel, Switzerland). The stained embryos were dehydrated in glycerol and photographed with a Nikon SMZ1500 stereomicroscope (Nikon ...
-
bioRxiv - Genomics 2023Quote: ... accession numbers OY726585 and OY726586) were indirectly labeled by PCR in the presence of biotin-16-dUTP (Roche Diagnostics) detected by streptavidin-Cy3 (Sigma–Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... In situ hybridization was performed as previously described19 with custom anti-sense DIG-labeled riboprobes transcribed in vitro (Roche) from amplified cDNA (see Key Resources Table for primers) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We synthesized digoxigenin (DIG)-labeled sense and antisense RNA probes using a DIG RNA Labeling Kit (Roche, Basel, Switzerland) after digestion with the appropriate restriction enzymes BamHⅠ-HF ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting PCR product was used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymerase T7 or Sp6 (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated with 1 nM DIG (Digoxigenin)-labeled Telomere probes in Hybridization solution (DIG Easy Hyb, Roche) at 42°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and used to produce the DIG-labeled single-stranded RNA probes using the DIG RNA labeling kit (Roche, #11175025910). Probes were then cleaned with MegaClear Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was first eluted from the column in 100 µL DNA elution buffer and subsequently the column was treated with recombinant DNase I (20 units/100 µL; Roche Diagnostics) for 30 min at 37°C and finally RNA was eluted in 50 µL nuclease free water ...
-
bioRxiv - Immunology 2021Quote: ... PBMC were seeded at 1 × 106 cells/mL in erythroid differentiation-promoting medium based on StemSpan™ Serum-Free Expansion Medium (SFEM) supplemented with human recombinant EPO (2 U/ml, Roche), human recombinant stem cell factor (25 ng/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two milligrams recombinant MYC and 12 μl T7-HCF-1VIC were rotated overnight at 4°C in Kischkel buffer + PIC (Roche 05056489001). Anti-FLAG M2 Affinity Gel (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-GFP (Roche, 11814460001); mouse monoclonal anti-c-myc 9E10 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... or 1:500 mouse αFLAG (Roche) and 2° 1:5,000 sheepαmouse (Amersham).
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-BrdU (Roche, Basel, Switzerland) mixed in TBS+ solution for 30-48 h ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-GFP (1:300, Roche), rabbit anti-GFP (1:300 ...
-
bioRxiv - Cell Biology 2019Quote: ... probing with mouse anti-GFP (Roche) and anti-α-Tubulin antibodies [DM1A] (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-HA (1:500; Roche). To improve the immunoreactivity of some synaptic markers ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-Myc mouse monoclonal antibodies (Roche) or anti-GFP mouse antibodies (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-GFP mouse antibodies (Roche) followed ...
-
bioRxiv - Systems Biology 2021Quote: ... and GFP (mouse monoclonal; Roche Diagnostics). For microscopy ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche, 1:1000). Shield-1 (Shld1 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse anti-GFP (Roche, 11814460001). Secondary antibodies were anti-mouse or anti-rabbit HRP conjugates (Dianova ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP mouse monoclonal antibody (Roche); anti-mCherry mouse monoclonal antibody (Abmart) ...
-
bioRxiv - Developmental Biology 2022Quote: ... or mouse anti-Biotin (Roche#1297597) primary antisera followed by appropriate AlexaFluor488 ...