Labshake search
Citations for Roche :
501 - 550 of 1606 citations for Recombinant Human Pappalysin 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2 supplemented with protease and phosphatase inhibitor cocktails (Roche)) for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 M NaCl with Complete protease inhibitor tablet (Roche, Indianapolis, IN) and centrifuged for 30 min at 13,000 rpm 4°C to pellet cell debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM EDTA) supplemented with EDTA-free protease inhibitor cocktail (Roche), phosphatase inhibitor (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Plant Biology 2019Quote: ... cOmplete mini protease inhibitor cocktail (2% v/v; Roche Molecular Biochemicals). Before NMR analysis D2O (5% to 10% v/v depending on frequency of spectrometer ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 2 mg/mL of collagenase A (Roche, Basel, Switzerland) and 1× DNase I (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated in blocking buffer (2% blocking reagent (Roche, 11096176001) in 1x TNT ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was permeabilised in 2% Triton-X-100 (Roche, 40319421) in PBS and subsequently incubated in PBSGT blocking solution (0.2% gelatin ...
-
bioRxiv - Systems Biology 2021Quote: ... 2% fatty acid-free bovine serum albumin (BSA) fraction V (Roche), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 mL ready-to-use CDP-Star® (Roche, USA) was added to cover the blot completely ...
-
bioRxiv - Neuroscience 2020Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cartilage explants were incubated with 2 mg/ml pronase solution (Roche) for 90 minutes at 37°C and digested overnight at 37°C in 1.5 mg/ml collagenase B solution (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with Protease inhibitors (Complete EDTA-free, Roche). Media and cell lysates were pre-cleared and the protein of interest was immunoprecipitated ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with cOmplete EDTA-free protease inhibitors (Roche). Subcellular fractionation by differential centrifugation was performed as described in (Geladaki et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... in 2 ml PBS with complete protease inhibitor (Roche Applied Science), PhosSTOP (Roche Applied Science) ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM MgCl2 supplemented with cOmplete Protease Inhibitor Cocktail tablets (Roche) and benzonase (Merk Millipore) ...
-
bioRxiv - Developmental Biology 2019Quote: ... washed several times and blocked with TNB [2% DIG Block (Roche) in TNT] for 1 hour ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM EDTA) in the presence of protease inhibitor cocktails (Roche) for 20 min at 4°C ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2□mM MgCl2) containing an additional proteinase inhibitor (Complete, Roche) and an RNAse inhibitor 40 U/μL (RNAseOUT ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubating with 2 Wunsch units of Liberase TM (Roche, Basel, Switzerland) in 2ml Ca2+ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM 2-Mercaptoethanol and cOmplete EDTA-free protease inhibitors (Roche) were added to the pre-cold lysis buffer right before use ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mM PMSF) supplemented with EDTA-free protease inhibitor cocktail (Roche), and 1.1% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... 10□µL of 2× KAPA HiFi HotStart PCR mix (Roche, Switzerland), and PCR grade water to final volume ...
-
bioRxiv - Genetics 2020Quote: ... 2 mM EDTA) containing protease and phosphatase inhibitors (Roche, Basel, Switzerland). Protein content was measured using the Bradford reagent (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... 2× concentration of protease inhibitor cocktail (cOmplete, EDTA free #05056489001, Roche), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Microbiology 2021Quote: ... and treated for 2 hours with 10U/ml DNase-I (Roche) before being concentrated by ultracentrifugation through a 20% sucrose/PBS cushion (28,000 rpm on a Sorvall Surespin rotor ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 2% SDS) with proteinase K (0.17 mg/mL, Roche Diagnostics) and inactivated 10 min at 95°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.5% NP-40) and 2 µl protease K (Roche, Cat 10910000) for at least 3hrs at 55℃ ...