Labshake search
Citations for Roche :
101 - 150 of 871 citations for Recombinant Human LILRB2 Protein Fc Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Microbiology 2020Quote: Biotinylated HIV-1 FISH probes were prepared with the Nick Translation Kit (Roche, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Biotinylated RNAs were transcribed in vitro with Biotin-RNA Labeling Mix (Roche, Indianapolis, IN) and purified with quick spin RNA columns (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...
-
bioRxiv - Biophysics 2020Quote: ... fibronectin from human plasma (Roche), the final concentration used for the experiments was 50 μg/ml (containing 2/3 of bovine and 1/3 of human FN) ...
-
bioRxiv - Developmental Biology 2019Quote: ... human holotransferrin 0.6% (Roche, 10652202001); monothioglycerol 0.0039 % (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... Human fibronectin (Roche Diagnostics, 11051407001); Puromycin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and human insulin (11376497, Roche) were digested with recombinant WT or protease-dead (cf-E111Q ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The extracted RNA was then treated with DNase I recombinant RNase free (Roche) and the reverse transcription was done using the Super-Script IV (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μg of total RNA was incubated with recombinant DNase I (Roche, 04716728001) for 30 min at 37°C and the reaction was stopped by incubation at 75°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Residual genomic DNA contamination was removed by treatment with recombinant DNAse I (Roche). cDNA was generated using Superscript II reverse transcriptase and Oligo d(T ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant lentiviruses were produced by transfecting HEK293T cells using FuGENE®6 (Roche) with plasmids encoding viral enzymes and envelope proteins essential for packing of viral particles (pRSV-EV ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Microbiology 2023Quote: DNase treatment was performed using recombinant RNase-free DNase I (Roche, Basel, Switzerland) according to the manufacturer’s protocols for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Microbiology 2023Quote: ... 1X antibiotic-antimycotic) with 100 U/mL recombinant interleukin (IL)-2 (Roche #11147528001) and activated or frozen in freezing media (90% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: Targeted capture was performed using a custom pool of biotinylated capture probes (SeqCap EZ Prime Choice, Roche) targeting 97 genes recurrently mutated in myeloid malignancies and clonal hematopoiesis spanning 347 kb (Table S2) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... His-tagged AtTPL188 (wt and mutants) bacteria pellets were resuspended in buffer A with EDTA-free antiprotease (Roche). The soluble fractions recovered after sonication were passed through a Ni-sepharose (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatants containing the His-tagged histones were combined with NiNTA resin (Complete His-Tag purification Resin, Roche) (1mL of Ni-NTA per 1L of bacteria ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 g/ml human transferrin (Roche), 5 ng/ml VEGF (PeproTech 450-32) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 180 μg/ml human transferrin (Roche). Flk-1+ cells were isolated by magnetic cell sorting (MACS ...