Labshake search
Citations for Roche :
151 - 200 of 948 citations for Recombinant Human KDR Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Biotinylated RNAs were transcribed in vitro with Biotin-RNA Labeling Mix (Roche, Indianapolis, IN) and purified with quick spin RNA columns (Roche ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and DNA libraries were amplified with KAPA 2X Hi-Fi Hotstart Readymix (Roche).
-
bioRxiv - Biophysics 2019Quote: ... the crude extracts mixed with cOmplete His-Tag purification resin (Roche, Basel, Switzerland) were loaded onto a polyprep chromatography column (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full length cDNA amplification with Hi-Fi Hotstart Readymix (Roche, cat. no. 07959079001) was completed with a 98°C incubation then 21 cycles of (98°C for 15 sec ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 µL of the Ni-NTA slurry (Roche cOmplete His-Tag purification resin) was washed with 2x1 mL of wash buffer (WB ...
-
bioRxiv - Molecular Biology 2023Quote: ... After gap repair with Kapa Hi-Fi HotStart Uracil+ DNA Polymerase (KAPA Biosystems) and Taq DNA Ligase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the supernatant was loaded into cOmplete™ His-Tag Purification Resin (Roche) pre-equilibrated with wash buffer ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... or zebrafish genomic DNA using the Expand Hi-Fidelity PCR System (11732641001, Roche). Exact coordinates are listed in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants after high-speed centrifugation were loaded onto His-Tag Purific Resin (Roche), washed and eluted with 50 mM Tris.HCl pH 7.5 ...
-
bioRxiv - Genomics 2024Quote: ... The cleared lysate was loaded onto a cOmplete His-tag purification column (Roche) and the His6-Sumo3-Tn5 was eluted with a running buffer containing 300 mM imidazole ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Molecular Biology 2019Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) and incubated for 1 h at room temperature or 2 h at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was added to a slurry of cOmplete His-Tag Purification Resin (Roche) or Ni Sepharose High Performance (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... Fab was purified from cell culture supernatant by cOmplete His-Tag Purification Resin (Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was added to cOmplete His-Tag Purification Resin (Merck Millipore/Roche) and incubated at 4°C for 1.5 h ...
-
bioRxiv - Genomics 2024Quote: ... the dialyzed sample was loaded again onto a cOmplete His-tag purification column (Roche), and the untagged Tn5 was collected in the flow-through ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by PCR amplification with KAPA 2X Hi-Fi Hotstart Readymix (Roche, Cat. No. KR0370).
-
bioRxiv - Biochemistry 2019Quote: ... Clear lysate was affinity-purified by incubating it with cOmplete His-Tag purification resin (Roche) for 2 hours (4°C) ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... The supernatants were then incubated with the Complete His-Tag Purification Resin (Roche, Basel, Switzerland) that had been prewashed with Renz buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... supernatants were harvested and purified using His-Tag purification resin (Roche, cOmpelteTM, Cat No.5893682001), followed by size-exclusion chromatography in 20 M Hepes or Tris pH 8 ...
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...
-
bioRxiv - Biophysics 2020Quote: ... fibronectin from human plasma (Roche), the final concentration used for the experiments was 50 μg/ml (containing 2/3 of bovine and 1/3 of human FN) ...
-
bioRxiv - Developmental Biology 2019Quote: ... human holotransferrin 0.6% (Roche, 10652202001); monothioglycerol 0.0039 % (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... Human fibronectin (Roche Diagnostics, 11051407001); Puromycin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and human insulin (11376497, Roche) were digested with recombinant WT or protease-dead (cf-E111Q ...