Labshake search
Citations for Roche :
451 - 500 of 1073 citations for Recombinant Human Interleukin 3 Receptor Alpha Low Affinity His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... enzymatic digestion was carried out for 20-25 min at 36 °C in the low-Ca2+ solution containing Liberase TH Research Grade (0.15 mg/mL; Roche) and elastase (0.5 mg/mL ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... The resulting lysate was cleared by centrifugation (13 000 g, 40 min, 4°C) and the supernatant was incubated with cOmplete His-tag purification resin (Roche, Germany) and allowed to bind overnight at 4°C with gentle agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mg of nuclear extract of KDM3A and KDM3B endogenously tagged ESCs (prepared as above) was incubated with 10 µg of HA antibody (Roche, clone 12ca5, catalog#11583816001) for 4 hours rotating at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... pH 7.4) for 30 min and subsequently incubated 1 h with anti-HA-peroxidase high-affinity monoclonal rat antibody (3F10; Roche [catalog no. 12013819001]) diluted 1:1000 in 2.5% (w/v ...
-
bioRxiv - Genomics 2019Quote: ... and 5 refers to the CRE Number and Affinity library) and with KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems, Wilmington, MA) following the recommended cycling protocol at 14 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Triplicate no-template controls contained 1x KAPA Sybr Fast Low-Rox qPCR Master Mix (KK4621; Roche Sequencing, Pleasanton, CA, USA) with 200 nM each primer and water only ...
-
bioRxiv - Genetics 2021Quote: ... livers were perfused at low flow for approximately 10 min with Digestion Buffer (low glucose DMEM supplemented with 1 mM HEPES) containing freshly added Liberase TM (32 μg/mL; Roche). Digestion was stopped using Isolation Buffer (low glucose DMEM supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... qRT-PCR was done in triplicate with PerfeCTa qPCR SuperMix Low ROX (Quanta Biosciences) with gene specific probes (Universal Probe Library, UPL, Roche) and primers ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... baseline serum total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels were measured with the cobas 6000 c501 Chemistry Analyzer (Roche) to confirm hypercholesterolemia in the HFD fed rats ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 and 12h node induced and contralateral uninduced tissues were dissected in ice cold 1x PBS and transferred to low binding PCR tubes containing 1x Protease Inhibitor Cocktail in 1xPBS (cOmplete mini EDTA-free; Roche) on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were resuspended in 200 µL low-salt Wash Buffer (20 mM HEPES-NaOH pH 7.5, 0.5 mM spermidine, 0.01% digitonin, 1x Roche protease inhibitor cocktail), the pA-MNase activated for 15 minutes at 0°C with 100 µL ice-cold Calcium Incubation Buffer (3.5 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Genomics 2023Quote: ... The membrane was then extensively washed with low and high stringency buffers and subsequently blocked with buffer B2 (1% Blocking powder [Roche] in buffer B1 [100 mM Maleic acid ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was performed using qScript (Quanta Biosciences) followed by real-time PCR using KAPA SYBR FAST ROX Low (Roche) on the ViiA 7 Real-Time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Bioengineering 2024Quote: ... livers were perfused at low flow for about 10 min with digestion buffer (low-glucose DMEM supplemented with 1 mM Hepes) containing freshly added Liberase (32 μg/ml; Roche). Digestion was stopped using isolation buffer (low-glucose DMEM supplemented with 10% FBS) ...
-
bioRxiv - Biochemistry 2020Quote: ... and the presence of enzymes were confirmed by immunoblot using the anti-His6 antibody conjugated to peroxidase (BMG–His-1 monoclonal antibody) (Roche, Mannheim, Germany).
-
bioRxiv - Biophysics 2022Quote: ... and mixed with 1 mL Ni Sepharose 6Fast Flow (Cytiva, Tokyo Japan) (MinD) or cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland) (MinE and msfGFP-MinC) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The quenched PFA solution was then removed and the tissue was resuspended in ice-cold Hi-C Lysis Buffer (10mM pH=8 Tris-HCl, 10mM NaCl, 0.2% NP-40 and 1x Roche Complete protease inhibitor). The lysis was helped with a Dounce Homogenizer Pestle A on ice (series of 10 strokes in 10’ intervals) ...
-
bioRxiv - Biochemistry 2023Quote: ... The soluble fraction of the cell lysate was transferred to a tube containing 30 μL cOMPLETE His-Tag purification Ni-NTA resin (Roche, Basel, Switzerland) suspended in 500 μL buffer A (8 M urea ...
-
bioRxiv - Immunology 2019Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The A20 cells were grown in RPMI-1640 (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... coated with 5 µg/ml human plasma fibronectin (Roche, 11080938001) in growth medium overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... and human Ki67 rabbit monoclonal antibody (Roche Diagnostics, 790-4286). Images were captured with VENTANA iScan HT (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.01 mg/mL of human insulin (Roche, Indianapolis, IN, USA), 10 mM HEPES (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... 500mM NaCl, 1mM TCEP-HCl (ThermoScientific, 20491) pH 7.4 which was supplemented with recombinant DNase I (1000U) (Roche,04536282001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... cells were resuspended in a 50 mM sodium phosphate buffer at pH 7.8 (buffer A) supplemented with DNase I (100 U, DNase I recombinant, RNase-free Roche), and disrupted using a French Pressure Cell (3 cycles at 1100 psi) ...
-
bioRxiv - Immunology 2019Quote: Purified B cells were cultured either in medium alone or in the presence of 1.56-25ng ml− of recombinant BAFF for the indicated time and stained with Annexin V (Roche) and 7-aminoactinomycin D (7-AAD ...
-
bioRxiv - Neuroscience 2021Quote: The tissue was dissociated in 300 µL of 0.25% trypsin-EDTA solution supplemented with 10 U/mL recombinant DNase I (Roche) for 15 minutes at 37°C ...