Labshake search
Citations for Roche :
51 - 100 of 840 citations for Recombinant Human ERN1 Protein GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Molecular Biology 2024Quote: ... GFP-tagged Myh was isolated from cell lysate using Dynabeads Protein G (Thermo 10004D) and GFP-tag Antibody (Roche #11814460001). IP and input were boiled in 5xLaemmli Buffer and separated on an SDS-PAGE (8-16% ...
-
bioRxiv - Cell Biology 2020Quote: ... using an anti-GST antibody (Roche Applied Science, Basel, CH).
-
bioRxiv - Immunology 2021Quote: Secreted twin strep-tagged gp140-soc proteins in the harvested and filtered supernatant (1L) were supplemented with protease inhibitor tablets (Roche Diagnostics) to prevent protein degradation and 5 ml of BioLock biotin blocking solution (iba Life Sciences GmbH ...
-
bioRxiv - Immunology 2021Quote: ... PBMC were seeded at 1 × 106 cells/mL in erythroid differentiation-promoting medium based on StemSpan™ Serum-Free Expansion Medium (SFEM) supplemented with human recombinant EPO (2 U/ml, Roche), human recombinant stem cell factor (25 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Molecular Biology 2019Quote: ... and mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) was used in the immunostaining assay.
-
bioRxiv - Molecular Biology 2022Quote: Recombinant HBsAg (Roche Diagnostics International) was used as a marker for aerosol formation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with recombinant DNase I (Roche) treatment ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and recombinant proteinase K (Roche). Samples were run on a 1% certified megabase agarose (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... the recombinant protein was expressed in HEK293T cells and released by 100 μM digitonin in PBS with protease inhibitor cocktail (Roche). The cell lysate prepared with the same method from HEK293T was used as the negative control.
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... and GFP- tagged pCREB3L3 using X-tremeGENE 9 (Roche). Cells were grown on coverslips ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant IFN-α2a (Roferon L03AB04, Roche) and IFN-λ1 (Peprotech 300-02L ...
-
bioRxiv - Neuroscience 2022Quote: ... tagged cDNA synthesized using the KAPA mRNA HyperPrep kit (Roche). The prepared libraries were sequenced on an Illumina NextSeq 500 using High Output Flowcell Cartridge from the NextSeq 500/550 Output v2 kit (75 cycles ...
-
bioRxiv - Immunology 2022Quote: ... DNAse I recombinant (Roche by Sigma Aldrich) and sodium pyruvate (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Immunology 2023Quote: ... 100 units/mL recombinant IL-2 (Roche), and 5 μg/mL PHA (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Cell Biology 2020Quote: 20,000 endogenously tagged HEK293T cells were grown on a fibronectin (Roche)-coated 96-well glass bottom plate (Cellvis ...
-
bioRxiv - Genetics 2021Quote: ... plus 1µI of alkaline phosphatase tagged anti-fluorescein F(ab) (Roche), followed by four washes at RT in 100 mM Tris pH7.55 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Molecular Biology 2019Quote: ... Labelling and detection used random prime labelling incorporating fluorescein tagged dUTP (Roche). Following probing ...
-
bioRxiv - Microbiology 2020Quote: ... His-tagged CopS(34-151) was purified using Ni-NTA columns (Roche)(11) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged ecMSG was loaded onto a gravity nickel affinity column (Roche) and eluted using 300 mM imidazole ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of tagged constructs was done using: HA-peroxidase antibody (Roche, ref: 12013819001), anti- TAP antibody (Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with recombinant DNASE I (1000 U) (Roche, 0453628001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by the treatment with recombinant DNase I (Roche). 1 µg of the obtained RNA was used for cDNA synthesis using Superscript III (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin-2 (20U/ml; Hoffmann-La Roche). Fresh medium containing IL-2 was added twice per week ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Immunology 2023Quote: ... and 50 ng/mL recombinant DNase I (Roche Diagnostics) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Bioengineering 2019Quote: ... Human Fibronectin (Roche). Agar low melting point ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Biophysics 2020Quote: ... the pool was loaded in 0.5 mL GST resin mixed with 1 mL of cOmplete His-tag purification resin (Roche) stacked in a 12 mL polyprep column ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...