Labshake search
Citations for Roche :
351 - 400 of 409 citations for Recombinant Human DDC His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng of labeled probe was mixed with 10 μg of human Cot-1 DNA (Roche) and 10 μg each of salmon sperm DNA and E ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library (UPL) Probefinder software for human (Roche, version 2.53) or using previously published sequences and adjusted to be intron-spanning ...
-
bioRxiv - Immunology 2019Quote: For the in vitro cell stimulation and maintenance reagents were as follows: human IL-2 (Roche); IL-21 (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used for the immunostaining include human ERα rabbit monoclonal antibody (Roche Diagnostics, 790-4325), human PR rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regions to sequence were selected with the SeqCap EZ Human Exome Library v3.0 (Roche Applied Science) according to the manufacturer’s instructions and underwent 2 × 151 base-pair sequencing on Hiseq 4000 (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... were transfected into the human 293FT cell line using X-tremeGENE 9 DNA transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Vector DNA was transiently transfected into human embryonic kidney (HEK) cells using Fugene-6 (Roche Molecular Biochemicals) transfection reagent ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Immunology 2021Quote: Total RNA was retrotranscribed and cDNA was quantified using the Universal Human Probe Roche library (Roche Diagnostics). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... and goat anti-human AF647 (Stratech 109-606-088- JIR)) DNA was then stained with DAPI (Roche) and coverslips mounted with Vectashield (Vector Laboratories - Vector H-1000).
-
bioRxiv - Immunology 2024Quote: Mice or Human CD4 T cells were lysed using RIPA buffer supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitors (Pierce) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Synthetic Biology 2019Quote: ... and the candidates were PCR amplified from a U2OS (human bone osteosarcoma cell line) genome prep as template with the Kapa Hifi Hotstart Polymerase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity assays were performed as described29 (with minor changes. Proliferation of human cells was assessed using an MTT colorimetric assay (Cell Proliferation Kit I, Roche). HeLa (epithelial cells ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Immunology 2022Quote: ... The normalization of DNA amount was performed by quantifying albumin gene copies with qPCR using human genomic DNA (20 ng/µl) standard (Roche, #11691112001) as we previously described16.
-
bioRxiv - Microbiology 2019Quote: ... while all other specific primers were designed to be compatible with the Human Universal Probe Library set (90 probes, octamer, Roche Diagnostics) (Supplementary Table 9 ...
-
bioRxiv - Immunology 2019Quote: ... the wells were washed five times and incubated with 100 µl/well goat anti-human IgG conjugated with alkaline phosphatase (Roche Diagnostics) diluted 1 in 5,000 for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 30 min in Ringer solution before plating on fibronectin-coated glass coverslips (human plasma fibronectin at 10 µg/ml, Roche 10838039001).
-
bioRxiv - Microbiology 2021Quote: ... and washed once in cell lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) prior to processing lysates ...
-
bioRxiv - Microbiology 2021Quote: ... falciparum 3D7 or HEK 293F cells were suspended in 1× pellet volume of lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Resuspended parasites were then transferred to a prechilled nitrogen cavitation chamber (Parr Instrument Company ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human samples were analyzed using a combination of gene-specific primers and Universal Probe Library (UPL) hydrolysis probes (Roche Life Science). Threshold cycle (Ct ...