Labshake search
Citations for Roche :
301 - 350 of 911 citations for Recombinant Human Carboxylesterase 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.01 mg/mL human insulin (Roche, Indianapolis, IN, USA), 100 IU penicillin (Mediatech) ...
-
bioRxiv - Cancer Biology 2023Quote: ... human PR rabbit monoclonal antibody (Roche Diagnostics, 790-4296), and human Ki67 rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... The resulting lysate was cleared by centrifugation (13 000 g, 40 min, 4°C) and the supernatant was incubated with cOmplete His-tag purification resin (Roche, Germany) and allowed to bind overnight at 4°C with gentle agitation ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mg of nuclear extract of KDM3A and KDM3B endogenously tagged ESCs (prepared as above) was incubated with 10 µg of HA antibody (Roche, clone 12ca5, catalog#11583816001) for 4 hours rotating at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... and the presence of enzymes were confirmed by immunoblot using the anti-His6 antibody conjugated to peroxidase (BMG–His-1 monoclonal antibody) (Roche, Mannheim, Germany).
-
bioRxiv - Biophysics 2022Quote: ... and mixed with 1 mL Ni Sepharose 6Fast Flow (Cytiva, Tokyo Japan) (MinD) or cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland) (MinE and msfGFP-MinC) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The quenched PFA solution was then removed and the tissue was resuspended in ice-cold Hi-C Lysis Buffer (10mM pH=8 Tris-HCl, 10mM NaCl, 0.2% NP-40 and 1x Roche Complete protease inhibitor). The lysis was helped with a Dounce Homogenizer Pestle A on ice (series of 10 strokes in 10’ intervals) ...
-
bioRxiv - Biochemistry 2023Quote: ... The soluble fraction of the cell lysate was transferred to a tube containing 30 μL cOMPLETE His-Tag purification Ni-NTA resin (Roche, Basel, Switzerland) suspended in 500 μL buffer A (8 M urea ...
-
bioRxiv - Immunology 2019Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The A20 cells were grown in RPMI-1640 (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... coated with 5 µg/ml human plasma fibronectin (Roche, 11080938001) in growth medium overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... and human Ki67 rabbit monoclonal antibody (Roche Diagnostics, 790-4286). Images were captured with VENTANA iScan HT (Roche Diagnostics ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.01 mg/mL of human insulin (Roche, Indianapolis, IN, USA), 10 mM HEPES (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... 500mM NaCl, 1mM TCEP-HCl (ThermoScientific, 20491) pH 7.4 which was supplemented with recombinant DNase I (1000U) (Roche,04536282001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... cells were resuspended in a 50 mM sodium phosphate buffer at pH 7.8 (buffer A) supplemented with DNase I (100 U, DNase I recombinant, RNase-free Roche), and disrupted using a French Pressure Cell (3 cycles at 1100 psi) ...
-
bioRxiv - Immunology 2019Quote: Purified B cells were cultured either in medium alone or in the presence of 1.56-25ng ml− of recombinant BAFF for the indicated time and stained with Annexin V (Roche) and 7-aminoactinomycin D (7-AAD ...
-
bioRxiv - Neuroscience 2021Quote: The tissue was dissociated in 300 µL of 0.25% trypsin-EDTA solution supplemented with 10 U/mL recombinant DNase I (Roche) for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... according to the manufacturer’s instructions and maintained in RPMI GlutaMax supplemented with 10% FCS and 30 U/ml recombinant IL-2 (Roche).
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...