Labshake search
Citations for Roche :
351 - 400 of 801 citations for Recombinant Human CHIT1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The relipidated proteins were treated with 1 mM AMPPNP (sodium salt, Roche) for overnight at 4 °C and desalted with a PD-10 column ...
-
bioRxiv - Plant Biology 2022Quote: ... and proteins were eluted by using 0.25 mg/ml HA peptide (Roche). HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immune complexes were captured using 20 µl Protein A agarose beads (Roche, previously saturated with 1 mg/ml BSA and 1mg/ml yeast tRNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and total serum protein (TSP) were determined using kits supplied by Roche Diagnostics and the Roche/Hitachi Analyzer machine at Al-Aulaqi Specialized Medical Laboratory ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were detected using monoclonal anti‐GFP (mouse; 1:3000; Roche 11814460001). Secondary antibody was HRP‐linked anti‐mouse polyclonal (goat ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were extracted using EB2 supplemented with 1X PhosSTOP (Roche, Indianapolis, IN) and FLAG immunoprecipitation was performed using anti-FLAG M2 agarose (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA-protein complexes were immunoprecipitated using a monoclonal anti-GFP antibody (Roche). Analysis of enrichment of target genes was performed by qPCR using the oligos listed in the Table S2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and proteins were digested with 0.04 mg/mL proteinase K (Roche #03115852001). DNA was recovered using a DNA purification kit (Bioline #52060) ...
-
bioRxiv - Neuroscience 2022Quote: ... protein G-Sepharose Fast Flow and immobilized streptavidin Mutein Matrix from Roche; protein molecular weight standards from Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... proteins were extracted using RIPA (Triton 1%) buffer supplemented with protease (Roche) and phosphatase inhibitors (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... After last wash proteins were cleaved by adding sequencing grade trypsin (Roche) in a 1:100 trypsin:protein ratio ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Fusion proteins were detected with α-Myc monoclonal antibodies (Roche, Stockholm, Sweden). The following constructs were used ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μl of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Microbiology 2023Quote: ... and pre-cleared with 80 μL of Protein-A agarose (Roche, www.roche.com) and 100 μg BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... and subsequently incubated with 20 μL of protein G-agarose beads (Roche) or protein A-agarose beads (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were then degraded by addition of 50 µg Proteinase K (Roche) and incubation at 56°C for 90 minutes ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were suspended in in cOmplete Protease Inhibitor Cocktail (Roche) containing radio-immunoprecipitation assay (RIPA ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell lysates were incubated further with protein G sepharose beads (Roche Applied Bioscience) for 2 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Pull-down was performed with 30 µl protein-G-agarose bead slurry (Roche) for 1 hr at 4°C under gentle agitation ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg of protein lysate was incubated with 1μg anti HA-antibody (Roche) overnight at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: Protein blots were probed either directly with a Streptavidin-alkaline phosphatase conjugate (Roche) or with antibodies raised against GFP (Sicgen ...
-
bioRxiv - Plant Biology 2020Quote: ... The immunoprecipitated proteins were detected by Western-blotting using anti-HA antibody (Roche) and anti-Flag antibody (Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... followed by a 2 h incubation with Protein A Agarose beads (Roche, 11719408001) at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and protease and phosphatase inhibitors to isolate insoluble proteins and S7 nuclease (Roche) to release DNA bound proteins ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected with primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:1000 and rabbit α-PfHP1 12 ...
-
bioRxiv - Biochemistry 2021Quote: Protein was collected from cells lysed in RIPA buffer with protease inhibitor (Roche). Protein extracts were passed through a 25g needle to break up DNA and subsequently quantified using BCA assay ...
-
bioRxiv - Plant Biology 2021Quote: ... proteins were electroblotted to PVDF membrane and probed with specific antibodies: αHA (Roche), αGFP (Milteny Biotech) ...
-
bioRxiv - Cell Biology 2022Quote: ... Antigen-antibodies complexes were pulled down using Protein G-Agarose (Roche, Lot #70470320). First ...
-
bioRxiv - Plant Biology 2020Quote: ... Total proteins were extracted in the extraction buffer containing protease inhibitor cocktail (Roche) as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... Soluble protein fractures were then mixed with 5x sample loading buffer (Roche, USA) and boiled for 5 min ...
-
bioRxiv - Cell Biology 2019Quote: GFP-Pav and Tum proteins were incubated with mouse anti-GFP antibody (Roche) overnight at 4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... and protein was removed by digestion with 1.2 mg/mL proteinase K (Roche) in proteinase K buffer (50 mM Tris-HCl at pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: Protein was extracted by RIPA buffer supplemented with protease inhibitor cocktail tablets (Roche). The proteins were separated in 10% SDS-PAGE with Mini-PROTEAN Electrophoresis System (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... Proteins were then digested using 88 μg/mL of Proteinase K (03115828001, Roche) during 1 hour at 65°C ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins were digested for 18 h at 37°C with chymotrypsin (Roche, Germany), followed by 3 h at 37°C using trypsin (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 750 μgs of protein were incubated with 20 μL of FLAG-beads (Roche) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% (v/v) glycerol) in the presence of cOmplete protein inhibitor cocktail (Roche). Both were then lysed in a cell disruptor (Constant Systems Ltd. ...