Labshake search
Citations for Roche :
551 - 600 of 948 citations for Recombinant Human CD3E Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell lysates were incubated further with protein G sepharose beads (Roche Applied Bioscience) for 2 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Pull-down was performed with 30 µl protein-G-agarose bead slurry (Roche) for 1 hr at 4°C under gentle agitation ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg of protein lysate was incubated with 1μg anti HA-antibody (Roche) overnight at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: Protein blots were probed either directly with a Streptavidin-alkaline phosphatase conjugate (Roche) or with antibodies raised against GFP (Sicgen ...
-
bioRxiv - Plant Biology 2020Quote: ... The immunoprecipitated proteins were detected by Western-blotting using anti-HA antibody (Roche) and anti-Flag antibody (Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... followed by a 2 h incubation with Protein A Agarose beads (Roche, 11719408001) at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and protease and phosphatase inhibitors to isolate insoluble proteins and S7 nuclease (Roche) to release DNA bound proteins ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected with primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:1000 and rabbit α-PfHP1 12 ...
-
bioRxiv - Biochemistry 2021Quote: Protein was collected from cells lysed in RIPA buffer with protease inhibitor (Roche). Protein extracts were passed through a 25g needle to break up DNA and subsequently quantified using BCA assay ...
-
bioRxiv - Plant Biology 2021Quote: ... proteins were electroblotted to PVDF membrane and probed with specific antibodies: αHA (Roche), αGFP (Milteny Biotech) ...
-
bioRxiv - Cell Biology 2022Quote: ... Antigen-antibodies complexes were pulled down using Protein G-Agarose (Roche, Lot #70470320). First ...
-
bioRxiv - Plant Biology 2020Quote: ... Total proteins were extracted in the extraction buffer containing protease inhibitor cocktail (Roche) as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... Soluble protein fractures were then mixed with 5x sample loading buffer (Roche, USA) and boiled for 5 min ...
-
bioRxiv - Cell Biology 2019Quote: GFP-Pav and Tum proteins were incubated with mouse anti-GFP antibody (Roche) overnight at 4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... and protein was removed by digestion with 1.2 mg/mL proteinase K (Roche) in proteinase K buffer (50 mM Tris-HCl at pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: Protein was extracted by RIPA buffer supplemented with protease inhibitor cocktail tablets (Roche). The proteins were separated in 10% SDS-PAGE with Mini-PROTEAN Electrophoresis System (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... Proteins were then digested using 88 μg/mL of Proteinase K (03115828001, Roche) during 1 hour at 65°C ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins were digested for 18 h at 37°C with chymotrypsin (Roche, Germany), followed by 3 h at 37°C using trypsin (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 750 μgs of protein were incubated with 20 μL of FLAG-beads (Roche) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% (v/v) glycerol) in the presence of cOmplete protein inhibitor cocktail (Roche). Both were then lysed in a cell disruptor (Constant Systems Ltd. ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were separated by standard SDS-PAGE and transferred to PVDF membranes (Roche) using a Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Plant Biology 2022Quote: ... Digestion of proteins was carried out by addition of trypsin (proteomics grade, Roche) at a 1/50 enzyme/protein ratio (w/w ...
-
bioRxiv - Molecular Biology 2023Quote: ... Urine was analyzed for Protein and Albumin (Cobas c 311 Analyzer; Roche Diagnostics).
-
bioRxiv - Molecular Biology 2023Quote: Predigested proteins and peptides were reduced with 10 mM dithiothreitol (DTT) (Roche, 10197777001) for 30 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... 80-100 μL of a mix of protein A and G-Agarose (Roche) was added to the samples ...
-
bioRxiv - Neuroscience 2022Quote: ... immunoprecipitated using 50µl packed Protein G beads bound with anti-GFP antibodies (Roche), and in vitro kinase assay was performed on these samples as described above ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein on the membrane were probed with antibodies (either anti-HA (Roche),-FLAG (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by a tryptic digestion (Roche, enzyme to protein ratio 1:50, MSgrade) and incubation at 37°C overnight in a thermal shaker at 700 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % Brij97 (v/v) and phosphatase and proteins inhibitors (Roche, # 4906837001 and # 4693132001) for 30 min under end over end rotation at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: Total protein extracts were prepared in RIPA buffer with protease inhibitor cocktail (Roche). Samples were sonicated for 3 minutes alterning 30seconds ON/ 30seconds OFF ...
-
bioRxiv - Cell Biology 2022Quote: Conjugation of protein or nanobody was performed with an 8-fold (Laminin; Roche) or 4-fold (R2-myc-his ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein extracts were used for immunoblot with anti-GFP (Roche #11814460001, 1:1,000), anti-RFP (Chromotek #6g6 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each resulting denatured protein sample was chemically reduced with 100 mM dithiothreitol (Roche) at 56°C for 30 min and alkylated using 100 mM iodoacetamide for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... After adding 50[μl of 50% of Protein-G bead (Roche Applied Science) to lysates and incubation with rotation at 4°C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes (175 mg protein) were treated with one cOmplete protease inhibitor tablet (Roche) then solubilised on ice at 4.5 mg mL−1 by the stepwise addition of lauryl maltose neopentyl glycol (LMNG ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were electrophoretically transferred overnight on to PVDF membrane (03010040001, Roche, Sigma-Aldrich). The membrane was blocked in 5% non-fat dry milk in TBS with 0.05% Tween 20 (TBST ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.