Labshake search
Citations for Roche :
101 - 150 of 855 citations for Recombinant Human CD244 Protein Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...
-
bioRxiv - Biophysics 2020Quote: ... fibronectin from human plasma (Roche), the final concentration used for the experiments was 50 μg/ml (containing 2/3 of bovine and 1/3 of human FN) ...
-
bioRxiv - Developmental Biology 2019Quote: ... human holotransferrin 0.6% (Roche, 10652202001); monothioglycerol 0.0039 % (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... Human fibronectin (Roche Diagnostics, 11051407001); Puromycin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and human insulin (11376497, Roche) were digested with recombinant WT or protease-dead (cf-E111Q ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The extracted RNA was then treated with DNase I recombinant RNase free (Roche) and the reverse transcription was done using the Super-Script IV (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μg of total RNA was incubated with recombinant DNase I (Roche, 04716728001) for 30 min at 37°C and the reaction was stopped by incubation at 75°C for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Residual genomic DNA contamination was removed by treatment with recombinant DNAse I (Roche). cDNA was generated using Superscript II reverse transcriptase and Oligo d(T ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant lentiviruses were produced by transfecting HEK293T cells using FuGENE®6 (Roche) with plasmids encoding viral enzymes and envelope proteins essential for packing of viral particles (pRSV-EV ...
-
bioRxiv - Microbiology 2023Quote: ... 1X antibiotic-antimycotic) with 100 U/mL recombinant interleukin (IL)-2 (Roche #11147528001) and activated or frozen in freezing media (90% FBS ...
-
bioRxiv - Microbiology 2023Quote: DNase treatment was performed using recombinant RNase-free DNase I (Roche, Basel, Switzerland) according to the manufacturer’s protocols for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Cancer Biology 2023Quote: Targeted capture was performed using a custom pool of biotinylated capture probes (SeqCap EZ Prime Choice, Roche) targeting 97 genes recurrently mutated in myeloid malignancies and clonal hematopoiesis spanning 347 kb (Table S2) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... His-tagged AtTPL188 (wt and mutants) bacteria pellets were resuspended in buffer A with EDTA-free antiprotease (Roche). The soluble fractions recovered after sonication were passed through a Ni-sepharose (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatants containing the His-tagged histones were combined with NiNTA resin (Complete His-Tag purification Resin, Roche) (1mL of Ni-NTA per 1L of bacteria ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 g/ml human transferrin (Roche), 5 ng/ml VEGF (PeproTech 450-32) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 180 μg/ml human transferrin (Roche). Flk-1+ cells were isolated by magnetic cell sorting (MACS ...
-
bioRxiv - Developmental Biology 2021Quote: ... F0425)/500 µg protein with protein A-agarose (Roche). Fished-out FGFR3 protein was eluted and then denatured at 95°C for 10 minutes in NuPAGE LDS sample buffer (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... Amplified libraries were subjected to hybridization with biotinylated oligonucleotide pools that were designed by the HyperDesign Team (Roche) and synthesized by Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was extracted from recombinant clones with the High Pure Isolation kit (Roche) as directed by the manufacturer and sequenced in an ABI PRISM 3100 genetic analyzer (Applied Biosystem ...
-
bioRxiv - Microbiology 2020Quote: ... the column was treated with recombinant DNase I (20 units/100 µL; Roche Diagnostics) for 30 min at 37°C and RNA was eluted in 50 µL nuclease free water ...