Labshake search
Citations for Roche :
151 - 200 of 1299 citations for Recombinant Human CD19 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... probes were labeled with digoxigenin-11-UTP (Roche Diagnostics), and the substrate was NBT/BCIP.
-
bioRxiv - Microbiology 2023Quote: ... and labeled with anti-HA (1:1000, 1hr; Roche). HA-tagged CDPK1 in the cWT and cMut lines was visualized with secondary goat antibodies (1:2000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase−labeled anti-digoxigenin and CDP-Star (Roche) substrate were used for detection of probe.
-
bioRxiv - Developmental Biology 2024Quote: Antisense digoxygenin-labeled probes (Genius kit; Roche, Indianapolis, IN) were synthesized using template cDNA encoding X ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Fixed and permeabilized embryos were incubated with DIG or Fluorescein-labeled RNA probes and the labeled probes were detected by Alkaline Phosphatase (AP)-conjugated primary antibodies (Roche Cat# 11093274910, RRID:AB_514497) and Roche Cat# 11426338910 ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Cell Biology 2021Quote: ... human plasma fibronectin (Roche) was conjugated with Atto-647N using a protein labeling kit (cat # 76508 Sigma-Aldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Human genomic DNA (Roche) was amplified ...
-
bioRxiv - Developmental Biology 2021Quote: ... the embryos were hybridized with DIG-labeled RNA probe (Roche) and DNP-labeled RNA probe (Mirus Bio) ...
-
bioRxiv - Genomics 2020Quote: ... and rhodamine-conjugated anti-digoxigenin for dig-labeled probe (Roche). The DNP-labeled probe was detected with rabbit anti-DNP ...
-
bioRxiv - Biochemistry 2019Quote: ... After DIG-labeled probe was visualized using BM purple (Roche), specimens were washed with PBST.
-
bioRxiv - Microbiology 2019Quote: ... and hybridized with PCR-generated digoxigenin-labeled probes (Roche Diagnostics) using DIG Easy Hyb hybridization solution (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2019Quote: ... RNA antisense probes were labeled with Digoxigenin-11-UTP (Roche). Hybridization was performed as described previously [19] ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA Probes were labeled with DIG-High prime (Roche, #1585606). The locations of DNA probes are indicated in Figure S2 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIG-labeled probes were visualized by HNPP/Fast Red (Roche) and Biotin-labeled probes were visualized by TSA kit (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNAse inhibitor and dig-labeled rNTPs (Roche, #3359247910 and 11277057001). Embryos were in situ hybridized according to (Harland and Biology ...
-
bioRxiv - Cell Biology 2021Quote: ... were labeled by random priming with digoxigenin-11-dUTP (Roche) or biotin-11-dUTP (PerkinElmer ...
-
bioRxiv - Neuroscience 2020Quote: ... Digoxigenin (DIG)-labeled DNA molecular weight maker III (Roche #11218603910) was loaded as a marker ...
-
bioRxiv - Cancer Biology 2019Quote: ... bacterial artificial chromosome (BAC) clones were labeled with biotin- (Roche), digoxigenin- (Roche ...
-
bioRxiv - Genomics 2021Quote: ... DIG was detected with an alkaline phosphatase labeled antibody (Roche).
-
bioRxiv - Developmental Biology 2023Quote: ... RNAse inhibitor and dig-labeled rNTPs (Roche, #3359247910 and 11277057001). Embryos were in situ hybridized according to (Harland and Biology ...
-
bioRxiv - Molecular Biology 2023Quote: ... integrating DIG-labeled ribonucleotides (BMB Cat. #1277073, Roche, Basel, Switzerland) following recommended protocols (https://www.rockefeller.edu/research/uploads/www.rockefeller.edu/sites/8/2018/10/FISHProtocolKSVRevised.pdf) ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The recombinant biotinylated A33-His antigen was immobilized on streptavidin (StreptaWells, Roche) or avidin coated wells (Avidin ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human CD4 clone SP35 and anti-human CD8 clone SP57 (Roche, Basel, Switzerland), and anti-human CD20 clone L26 Dako Omnis (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...
-
bioRxiv - Genomics 2020Quote: Digoxigenin-labeled riboprobes were synthesized with DIG RNA Labeling Mix (ROCHE), Thermo T7 RNA Polymerase (ToYoBo) ...
-
bioRxiv - Genomics 2019Quote: ... They were alternatively labeled using the Dig RNA labeling mix (Roche) or the biotin RNA labeling mix (Roche) ...
-
bioRxiv - Developmental Biology 2019Quote: ... in vitro transcription was performed with digoxigenin-labeled dUTP (Roche #11277073910), and the probe was purified with the MEGAclear Transcription Clean-up kit (Thermo #AM1908 ...
-
bioRxiv - Genomics 2019Quote: ... for biotin labeled probes and FITC-conjugated anti-digoxygenin (Roche, USA) for digoxigenin labeled probes ...
-
bioRxiv - Genetics 2021Quote: ... Slides were hybridized with digoxigenin-(or biotin-) labeled (Roche, Basel, Switzerland) human COT-1 DNA (ThermoFisher ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Digoxigenin-labeled c-fos sense and antisense probes (11277073910, Merk (Roche), UK ...