Labshake search
Citations for Roche :
601 - 650 of 1362 citations for Real Time Thermal Cycler Thermocycler Accessories since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR was performed using TB green Premix Taq on a LightCycler 480 Instrument II (Roche). Primers are listed in the Supplemental Materials ...
-
bioRxiv - Cell Biology 2021Quote: ... on the Real-Time PCR Systems (CFX96, Bio-Rad, USA; or LightCycler 96, Roche Life Science, Swiss). The primers used in this study are listed in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified DNA was quantified by real-time PCR with KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems) and gene-specific primers using the CFX Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Quantitative real-time PCR (RT-qPCR) was carried out in a LightCycler 96 System (Roche, Basel, Switzerland) using a KAPA SYBR FAST qPCR kit (KAPA Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using KOD SYBR qPCR (TOYOBO) and LightCycler 96 (Roche). Target gene expression was normalized on the basis of Gapdh content.
-
bioRxiv - Cell Biology 2022Quote: ... Real-time qPCR was performed using the UPL probe library system in a LightCycler 480 System (Roche). The real-time qPCR primers were designed using the universal probe library assay design center (Roche) ...
-
bioRxiv - Microbiology 2019Quote: Real-time PCR amplifications were carried out using LightCycler® 480 Probes Master kit (Roche diagnostics, France) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by real time quantitative PCR using Kapa SYBR Fast qPCR kit (Kapa Biosystems, Catalog No. KR0389_S) and Light Cycler 96 (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified DNA was quantified by real time PCR with KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems) and gene specific primers using a CFX Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... Analysis of gene expression was performed using a The LightCycler® 480 real-time PCR System (Roche). The gene ACT1 was used as endogenous control ...
-
bioRxiv - Genomics 2022Quote: Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using KAPA SYBR FAST (Kapa Biosystems KK4610) on a 384-well LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2022Quote: Barrier function was assessed using the xCELLigence Real-Time Cell Analyzer (RTCA, Acea Biosciences/Roche Applied Science) to measure electrical impedance across HUVEC monolayers seeded onto microelectrodes ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative real-time PCR (qRT-PCR) was conducted using a LightCycler® 96 Instrument (Roche Molecular Systems) and qRT-PCR reaction was performed with KAPA SYBR FAST qPCR kit (KAPA Biosystems) ...
-
bioRxiv - Developmental Biology 2019Quote: ... real-time PCR was performed on a StepOneTM system using using FastStart Universal SYBR Green Master (Roche). H2a was used as an endogenous control.
-
bioRxiv - Genomics 2019Quote: ... 0.5 ng of plasmid was amplified using primers with P5 and P7 Illumina flow cell adapter sequences (Libseq_P7_For and Libseq_P5_Rev) and KAPA HiFi HotStart Real-time PCR Master Mix (2X) (Kapa Biosystems) for 17 cycles ...
-
bioRxiv - Pathology 2020Quote: ... these protocols were adjusted to a real-time format with Green Essential FastStart Master kit (Roche Diagnostics), in a Nano LightCycler (Roche Diagnostics) ...
-
bioRxiv - Pathology 2020Quote: ... cDNA templates were used for real-time quantitative PCR with KAPA SYBR Fast qPCR kit (KAPA Biosystems) and analyzed with the Roche LightCycler 480 ...
-
bioRxiv - Plant Biology 2021Quote: ... The real-time quantitative PCR was performed using a LightCycler 480 system (Roche Applied Science, Mannheim, Germany). A PCR master mix was prepared with the LightCycler 480 SYBR Green I Master Kit (Roche Applied Science ...
-
bioRxiv - Immunology 2021Quote: ... NCR1 and NK1.1 was performed using real-time quantitative PCR (qPCR) on a LightCycler 480 II (Roche) under the following conditions ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR (qPCR) reactions were performed using the KAPA SYBR Fast qPCR Kit (Kapa Biosystems; KK4601), with gene-specific primers in technical triplicates and in biological triplicates (Neuro2a cells) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed using LightCycler FastStart DNA MasterPLUS SYBR Green I (Roche Diagnostics, Tokyo, Japan) on a LightCycler 96 (Roche) ...
-
bioRxiv - Pathology 2021Quote: Real-time quantitative PCR was performed using KAPA PROBE FAST Universal One-Step qRT-PCR (Roche, Switzerland) and a specific pair of primers and a probe for amplification and detection of ToBRFV (Table S1) ...
-
bioRxiv - Pathology 2021Quote: ... The amplification was performed on the LightCycler 480 real-time PCR instrument (Roche Diagnostics, Burgess Hill, UK) using SYBR® Premix Ex Taq™ (TaKaRa) ...
-
bioRxiv - Cancer Biology 2020Quote: ... real-time PCR was performed using the SYBR Green from Roche (Lightcycler 480 SYBR Green I Master) as per the manufacturer’s instructions using a Light Cycler II (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real-time PCR was performed on a Roche LightCycler 480 (Roche Diagnostics, Palo Alto, CA, USA) using SYBR Premix Ex Taq II (Tli RNaseH Plus ...
-
bioRxiv - Immunology 2020Quote: ... blood and BM cells for both species) with a LightCycler® 480 Real-Time PCR System (Roche). Gene expression was then assessed with the BioMark HD (Fluidigm ...
-
bioRxiv - Immunology 2021Quote: ... Enrichment of genomic DNA fragments by ChIP was validated by Real-time PCR (LightCycler® 480, Roche) with primers (Extended Data Table IV ...
-
bioRxiv - Immunology 2021Quote: ... Real-time quantitative polymerase chain reaction (qPCR) was performed using SYBR green PCR master mix (Kapa biosystems), forward and reverse primers (200 nM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time qPCR was performed using the UPL probe library system or SYBR green I master (Roche) in a LightCycler 480 System (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... The qRT-PCR analyses were performed on a Roche 480 real-time PCR system (Roche, Mannheim, Germany). The RNA levels were calculated as described by Livak and Schmittgen (2001) ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR assays were performed using the LightCycler FastStart DNA Master PLUS SYBR Green kit (Roche) and a LightCycler PCR instrument (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: Gene expression was determined by quantitative real-time PCR (qRT-PCR; LightCycler 480, Roche Diagnostics, Rotkreuz, Switzerland) using SYBR Premix Ex Taq™ (TaKaRa ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s instructions and real-time PCRs were performed on a LightCycler (Roche Diagnostics, France). No signal was detected in samples that did not undergo reverse transcription or in blank runs without cDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time PCR (qPCR) was carried out in the LightCycler 480 II system (Roche, Basel, Switzerland) using Universal ProbeLibrary (Roche ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative Real-Time PCR (qRT-PCR) was done using the LightCycler® 480 Instrument (Roche Applied Science) with FastStart Essential DNA Green Master Mix (Roche Life Science) ...
-
bioRxiv - Immunology 2023Quote: ... qRT-PCR reactions were performed on a LightCycler 96 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN). The reaction mixture was activated at 50°C for 2 min ...
-
bioRxiv - Genomics 2023Quote: Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using KAPA SYBR FAST (Kapa Biosystems KK4610) on a 384-well LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... according to the manufacturer’s protocol and monitored in real-time using LightCycler® 480 Instrument II (Roche). Relative gene expression was calculated using 2-ΔΔCq method ...
-
bioRxiv - Genomics 2022Quote: ... Gene expression was measured through quantitative real-time PCR (qPCR) using FastStart SYBR Green master mix (Roche) according to the manufacturer’s recommendations in a LightCycler 480 II device (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed in 96-well format using the quantitative real-time PCR System (Roche 480 LightCycler). 2 μL cDNA were added to a final reaction volume of 10 μL containing H2O ...
-
bioRxiv - Physiology 2023Quote: ... real-time RT-qPCR was performed using the Lightcycler® 480 II system (Roche Diagnostics, Basel, Switzerland) with primers designed based on (i ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time PCRs were carried out with the Fast Start Essential DNA Green Master kit (06402712001, Roche) and Bio-Rad CFX96 real-time PCR system ...
-
bioRxiv - Cancer Biology 2023Quote: ... and amplified with KAPA HiFi HotStart Real-time PCR using KAPA P5 and P7 primers (KAPA Biosystems).
-
bioRxiv - Physiology 2024Quote: ... Real-time PCR profiles were visualized using the commercially available FastStart Universal SYBR Green Mastermix (Roche, SUI) and Qiagen human Primer Assays (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... which was performed with the LightCycler® 2.0 Real-Time PCR System (Roche Life Sciences, Penzberg, Germany) using LightCycler® FastStart DNA Master SYBR® Green I (Roche Life Sciences ...
-
bioRxiv - Genetics 2024Quote: ... the SYBR Green I Master mix was used on a LightCycler 480 Real Time PCR System (Roche). The primers are listed in Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed on the resulting cDNA using a LightCycler 96 Real-Time PCR system (Roche) and Luna Universal qPCR Master Mix kit (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR was performed with LightCycler 480 SYBR Green I Master detection kit (Roche 04707516001) on a Light Cycler 480 machine (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proliferation rate in vitro was assessed using an xCELLigence Real-Time Cell Analyzer (RTCA) system (Roche Diagnostics)49 ...