Labshake search
Citations for Roche :
1 - 50 of 88 citations for Rcombinant Cynomolgus PDCD1LG2 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: NPCs derived from cynomolgus macaque (Cips_BC671A_NSC line generated at Roche) were differentiated in NPC differentiation medium (42) ...
-
bioRxiv - Molecular Biology 2019Quote: ... hybridized fluorescein tagged dUTP was detected with alkaline phosphatase tagged anti fluorescein Fab fragments (Roche), revealed with CDP-Star (GE Healthcare ...
-
bioRxiv - Genetics 2022Quote: ... MYC-tagged or FLAG-tagged recombinant proteins were captured using ~5μg antibody and Protein-Agarose beads (Roche Applied Science, 11243233001) according to the manufacturer’s protocol ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... and GFP- tagged pCREB3L3 using X-tremeGENE 9 (Roche). Cells were grown on coverslips ...
-
bioRxiv - Immunology 2020Quote: ... 1% FCS and 12.5µg/ml DNAse (Roche) in IMDM (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... tagged cDNA synthesized using the KAPA mRNA HyperPrep kit (Roche). The prepared libraries were sequenced on an Illumina NextSeq 500 using High Output Flowcell Cartridge from the NextSeq 500/550 Output v2 kit (75 cycles ...
-
bioRxiv - Cell Biology 2020Quote: 20,000 endogenously tagged HEK293T cells were grown on a fibronectin (Roche)-coated 96-well glass bottom plate (Cellvis ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected with mouse (Covance) or rat (Roche) monoclonal anti-V5 antibodies at 1 μg/ml or 12.5 ng/ml respectively ...
-
bioRxiv - Plant Biology 2021Quote: ... HA-tagged proteins were detected with Anti-HA-Peroxidase (Roche #12013819001) at a dilution of 1:5,000 ...
-
bioRxiv - Genetics 2019Quote: ... The GFP-tagged proteins were probed with anti-GFP antibody (Roche) (1:1,000 ...
-
bioRxiv - Genetics 2021Quote: ... plus 1µI of alkaline phosphatase tagged anti-fluorescein F(ab) (Roche), followed by four washes at RT in 100 mM Tris pH7.55 ...
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged proteins were detected with a mouse anti-FLAG (Roche) antibody diluted 1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal mouse antibodies were used to detect GFP-tagged proteins (Roche) (dilution 1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected with Anti-c-myc-Peroxidase (Roche #11814150001) at dilution of 1:5,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected using 1:1,000 anti-HA antibody (Roche) and 1:5,000 anti-rat antibody (Abcam) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Labelling and detection used random prime labelling incorporating fluorescein tagged dUTP (Roche). Following probing ...
-
bioRxiv - Microbiology 2020Quote: ... His-tagged CopS(34-151) was purified using Ni-NTA columns (Roche)(11) ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Biophysics 2022Quote: ... His-tagged ecMSG was loaded onto a gravity nickel affinity column (Roche) and eluted using 300 mM imidazole ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Detection of tagged constructs was done using: HA-peroxidase antibody (Roche, ref: 12013819001), anti- TAP antibody (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... GFP- or HA3x-tagged proteins were detected using α-GFP (1:1000; Roche) or α-HA3x (1:1000 ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with 2% FCS and 1mg/mL dispase II (Roche) overnight at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... GRA16HA (and other HA-tagged proteins) was detected using rat anti-HA antibodies (Roche) while GRA24MYC was detected using rabbit anti-MYC tag antibody 9E10 (Santa Cruz Biotechnology) ...
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected with a mouse anti-GFP antibody (1:5000; Roche). Immunoblot results were quantified using Image J software (v1.8.0).
-
bioRxiv - Biochemistry 2020Quote: ... GFP-tagged proteins were detected with a primary mouse antibody IgG1K Anti-GFP (Roche) diluted to 1:1000 in 5 % (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation (IP) of HA-tagged proteins was performed using Anti-HA Affinity matrix (Roche) under denaturing conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunoprecipitation of GFP/YFP-tagged proteins was performed with anti-GFP antibodies (11814460001, Roche) using a method we previously described (Ishii and Akiyoshi ...
-
bioRxiv - Cancer Biology 2019Quote: ... Hybridized probes were detected using anti-digoxigenin (DIG) antibodies tagged with alkaline-phosphatase (AP) (Roche) using NBT/BCIP (Roche ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... HA-tagged proteins were detected and visualized using an HA antibody conjugated to HRP (Roche). For anti-HA immunoprecipitations ...
-
bioRxiv - Plant Biology 2021Quote: ... HA and GFP-tagged fusion proteins were detected using a Peroxidase-conjugated α-HA (Roche) or α-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... Purified individually tagged libraries were quantified by qPCR using Kapa Lib Quant Kit (Roche Diagnostics). In conjunction with the qPCR Ct values we used a library size of 265 bp to calculate library molarity ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged proteins were detected using mouse anti-GFP antibody (Roche 1814460, 1:1000 dilution) and anti-mouse-HRP antibody (Amersham ...
-
bioRxiv - Plant Biology 2022Quote: ... HA- and FLAG-tagged proteins were immunologically detected using HRP-conjugated anti-HA 3F10 (Roche) and anti-FLAG M2 (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractionated samples were analyzed by SDS-PAGE and electrophoresis for detection of HA-tagged Nedd4 (Roche anti-HA high affinity,1:2000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.
-
bioRxiv - Bioengineering 2021Quote: ... Westernblot analysis of epitope-tagged PanK variants was performed with peroxidase-conjugated anti-HA antibody (Roche Diagnostics) and luminol-containing detection system ...
-
bioRxiv - Biochemistry 2020Quote: ... MR-Fc was purified from cell culture supernatant using Protein A-agarose beads (Roche). For ELISA experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... His-tagged AtTPL188 (wt and mutants) bacteria pellets were resuspended in buffer A with EDTA-free antiprotease (Roche). The soluble fractions recovered after sonication were passed through a Ni-sepharose (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatants containing the His-tagged histones were combined with NiNTA resin (Complete His-Tag purification Resin, Roche) (1mL of Ni-NTA per 1L of bacteria ...
-
bioRxiv - Cancer Biology 2023Quote: ... The His-tagged-TRF2TRFH protein was purified in presence of cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) by using Protino ® Ni-TED 2000 Packed Columns (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2023Quote: ... HA-and GFP-tagged proteins were detected using horseradish peroxidase–conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...