Labshake search
Citations for Roche :
301 - 350 of 10000+ citations for Rat Translational Activator Of Cytochrome C Oxidase 1 TACO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Coronal sections containing the medial prefrontal cortex (mPFC) or hippocampus were incubated with (1) an antibody cocktail of rat anti-HA (1:200, Cat. No. 10145700, Roche Diagnostics, USA) with rabbit anti-PV (1:500 ...
-
bioRxiv - Plant Biology 2023Quote: ... the membranes were incubated with primary antibody for 2.5 h (GFP, Abcam, Cambridge, UK: rabbit, 1:10000; HA [Roche], rat, 1:3000). Excess primary antibody was then removed by washing three times in 2x TBST (150 mM NaCl ...
-
bioRxiv - Genetics 2021Quote: ... Capture-C libraries were made using the Arima HiC kit (Arima Genomics) and the KAPA HyperPrep kit (KAPA Biosystems) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2019Quote: Rat ventricular myocytes were isolated from adult Sprague-Dawley rats (200 – 250 g) by enzymatic (Liberase™, Roche) digestion (Colecraft et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche Cat# 11867423001, RRID:AB_390918), mouse anti-Pan-Neurofascin external (clone A12/18 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat monoclonal anti-HA tag (Roche, 3F10); rabbit anti-Satb1(Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... rat α-HA (clone 3F10; Roche Diagnostics); mouse α-Myc (9E10 ...
-
bioRxiv - Cell Biology 2020Quote: ... and rat monoclonal anti-HA (Roche, 11867423001). All primary antibodies were used at a dilution of 1:500 in 10% FCS/PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche, 3F10, RRID: AB_390918), rabbit anti-Giantin (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... and rat anti-HA (3F10, Roche 11867423001). Primary polyclonal antibodies used and their sources were ...
-
bioRxiv - Neuroscience 2020Quote: ... or rat anti-HA-tag (Roche Diagnostics) or mouse anti-FlagM2 and rabbit anti-APP-CTF (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Ab anti-HA Ab (rat monoclonal, Roche), anti-GAPDH Ab (mouse monoclonal ...
-
bioRxiv - Cell Biology 2019Quote: ... Rat anti HA (Roche catalog number: 11867423001) was used at a dilution of 1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA rat monoclonal antibodies 3F10 (Roche) diluted to 1:125 followed by Alexa 488-conjugated anti-rat antibody (Molecular probes ...
-
bioRxiv - Biochemistry 2023Quote: ... Rat anti-HA tag (cat #11867423001, Roche), Sheep anti-PPM1H (DA018 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-HA (rat clone 3F10, Roche, ROAHAHA), anti-UL48 (mouse clone 1-21 ...
-
Tight junction membrane proteins regulate the mechanical resistance of the apical junctional complexbioRxiv - Cell Biology 2023Quote: ... rat monoclonal anti-HA (clone 3F10; Roche); and mouse monoclonal anti-FLAG (Wako ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies: rat anti-HA (Roche, # 12158167001) at 1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies: rat anti-HA (Roche, # 12158167001) at 1:200 ...
-
bioRxiv - Genetics 2023Quote: ... High Affinity (3F10) rat monoclonal antibody (Roche) was used to detect HA-tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary rat anti-HA antibody (11867423001, Roche) and secondary rabbit anti-rat (HRP ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CAT expression was quantified using the CAT ELISA (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking Reagent for ELISA (BRE) (11112589001) was manufactured by Roche. 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking reagent for ELISA (BRE, cat. 11112589001) was from Roche. DC Assay kit was from Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... DRG were incubated for 1 hour at 37 °C with 1 mg/ml dispase II (Roche) and 2 mg/ml collagenase A (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Microbiology 2020Quote: ... permeabilized and immunostained with the following primary antibodies - rat monoclonal anti-HA (clone 3F10, Roche: 1:250 dilution), mouse monoclonal anti-myc (clone 9B11 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were incubated in PEMBALG containing monoclonal anti-HA antibody produced in rat (1:1000 dilution, Roche) for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then incubated with 40 µL of primary antibody (1:1,000 rat anti-HA mAb 3F10, Roche) at 4°C overnight in a solution containing 3% BSA in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... The membranes were blocked using 10% skimmed milk in PBS containing 0.1% Tween 20 (PBST) and then incubated with rat anti-HA high affinity (1:1,000; Roche) and rabbit anti-T ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Neuroscience 2020Quote: ... for 1 hour at 37°C followed by Proteinase K (Roche 03115887001) for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... or monoclonal c-myc antibody (Roche, used at a 1/10000 dilution). Polyclonal and monoclonal antibodies were detected by goat anti-rabbit or anti-mouse IgG coupled to peroxidase (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Chromosome were blocked in PBT containing 0.2% BSA and 5% goat serum and sequentially incubated with primary antibodies (mouse anti-PolII H5 IgM, 1:1000, Abcam, and rat anti-HA MAb 3F10, 1:50, Roche, or rabbit anti-FLAG, 1:1000, SIGMA) followed by incubation with Alexa488- and/or Alexa647-coupled secondary antibodies (Molecular Probes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...
-
bioRxiv - Microbiology 2019Quote: ... Purified parasites treated at 12°C for 1 h with freshly prepared 1 mg/mL pronase (Roche)/0.01% saponin/PBS before washing ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were incubated for at least 1 h with a 1:1000 dilution of a high affinity anti-HA antibody from rat IgG1 (#11867423001, Roche Applied Science, Penzberg, Germany). Detection was carried out by incubating with a 1:4000 dilution of a rabbit anti-rat antibody conjugated to peroxidase (A5795 ...
-
bioRxiv - Genomics 2019Quote: TUNEL staining on rat β-cells was performed 48h after transfection using the TMR red In Situ Cell Death Detection Kit (Roche) combined to polyclonal guinea pig anti-insulin (dilution 1:40 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and rat anti-HA antibody (3F10, 11867423001, Roche) were mixed and incubated at 4°C for 1 hour with rotation ...
-
bioRxiv - Immunology 2022Quote: Rat spleen was digested by collagenase D (Roche) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-HA (Roche, 11-867-423-001) at 1:200 ...
-
bioRxiv - Immunology 2020Quote: ... α-HA high affinity rat monoclonal antibody (Roche; 3F10), α-strep (Genscript A00626) ...
-
bioRxiv - Microbiology 2019Quote: Rat anti-HA antibody clone 3F10 (Roche, #1867423) was used at a dilution 1/50 and mouse anti-HA (Covance ...
-
bioRxiv - Plant Biology 2021Quote: ... or horseradish peroxidase-conjugated rat α- HA (Roche) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... rat anti-HA-HRP 3F10 (Roche Applied Science), 1:2500-1:5000 and rabbit anti-Kar2 ...
-
bioRxiv - Cell Biology 2021Quote: ... rat anti-HA-HRP 3F10 (Roche Applied Science), 1:2500-1:5000 ...
-
bioRxiv - Plant Biology 2020Quote: ... we used rat anti-HA (Roche, 3F10 clone) at 1:7,000 dilution and goat anti-rat secondary (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... Rat monoclonal anti-HA antibody (clone 3F10, Roche) was used to detect epitope-tagged proteins ...