Labshake search
Citations for Roche :
1 - 50 of 5188 citations for Rat TNF alpha ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Physiology 2019Quote: ... the BrdU incorporation ELISA kit (Ref. 11647229; Roche) was used following manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... BrdU ELISA colorimetric kit was purchased from Roche-Sigma Aldrich (Indianapolis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the CAT ELISA kit (Roche, cat. # 11758241001). The ratios of CAT/βGAL were then analyzed to calculate the relative IRES activity.
-
bioRxiv - Systems Biology 2019Quote: For quantification of CAT expression we used an ELISA based assay (CAT ELISA Kit assay, Roche). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: The Telo TAGGG Telomerase PCR ELISA kit (Roche, Basel, Switzerland) was used to detect the telomerase activity of keratinocytes after UV irradiation ...
-
bioRxiv - Zoology 2021Quote: ... was determined from the cell lysate using an ELISA kit (Roche) in accordance with the company instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Molecular Biology 2021Quote: Cell proliferation was assessed by Cell Proliferation ELISA BrdU kit (11647229001, Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... BrdU incorporation was measured using BrdU Elisa kit (Roche Diagnostic, Manheim, Germany).
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Molecular Biology 2023Quote: ... DIG-labeled TER and alpha-tubulin probes were generated using the PCR DIG Probe Synthesis Kit (Roche) and used in the hybridization step (S1 Table ...
-
bioRxiv - Genomics 2024Quote: ... The probe was labeled with alpha-32P CTP using the High Prime DNA labeling kit (Roche, #11585584001). The labelled probe was purified on a G50 sephadex column (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: ... Proliferation was measured using the Cell Proliferation ELISA BrdU kit (Roche Diagnostics GmbH), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptosis was evaluated using the cell death detection ELISA kit (Roche, Basel, Switzerland). HUVEC were trypsinized ...
-
bioRxiv - Developmental Biology 2021Quote: ... BrdU incorporation was determined colorimetrically with the Cell proliferation ELISA kit (Roche, Basilea, Switzerland) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: Apoptosis was measured in freshly isolated islets using the Cell Death ELISA kit (Roche) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: Cell proliferation was evaluated using a colorimetric bromodeoxyuridine (BrdU) cell proliferation ELISA kit (Roche Diagnostics). After 20-h incubation period with BrdU ...
-
bioRxiv - Cancer Biology 2019Quote: Cell proliferation following different treatments was determined using chemiluminescent BrdU ELISA kit (Roche, catalog # 11669915001) as described by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... BrdU incorporation was measured using the Cell Proliferation ELISA kit (Roche #11-669-915-001) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... CAT expression was determined using an ELISA kit in accordance with the manufacturer’s instructions (Roche). Bovine IFN-α standards were used to construct a type I IFN standard curve to interpolate sera sample IFN levels.
-
bioRxiv - Biochemistry 2023Quote: DNA synthesis or replication was monitored by measuring the Cell Proliferation ELISA BrdU kit (Roche). Cells were cultured on a Nunc 96-well plate (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: Serum creatinine was determined using the creatininase/creatinase specific enzymatic method described by Bömer using a commercial kit (Alpha Laboratories Ltd. Eastleigh, UK) adapted for use on a Cobas Fara centrifugal analyser (Roche Diagnostics Ltd ...
-
bioRxiv - Molecular Biology 2021Quote: Serum albumin measurements were determined using a commercial serum albumin kit (Alpha Laboratories Ltd., Eastleigh, UK) adapted for use on Cobas Mira analyser (Roche Diagnostics Ltd ...
-
bioRxiv - Immunology 2022Quote: ... measured by RT ELISA (Roche), per well (MOI 0.2 ...
-
bioRxiv - Genomics 2023Quote: ... ELISA BrdU Colorimetric assay (Roche) was performed according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and rat anti-HA (rat mab 3F10; Roche, 1:200) antibodies diluted in blocking buffer ...
-
bioRxiv - Cancer Biology 2022Quote: -Rat Collagen: Type I rat tail Collagen (Roche, Manheim, Germany) was dissolved in 0.2% acetic acid to a final concentration of 3 mg/ml ...
-
bioRxiv - Cell Biology 2021Quote: Cell death (apoptosis) was measured using the Cell Death Detection ELISA kit (Roche Diagnostics, Madrid, Spain) while mitochondrial metabolism was assessed using the MTT assay ...
-
bioRxiv - Pathology 2020Quote: ... Quantitation of urinary albumin and creatinine was carried out using mouse albumin-specific ELISA kits (Roche) and creatinine determination kits (Enzymatic Method ...
-
bioRxiv - Physiology 2021Quote: Cell death (apoptosis) was measured using the Cell Death Detection ELISA kit (Roche Diagnostics, Madrid, Spain) as previously described 26.
-
bioRxiv - Cancer Biology 2021Quote: ... Proliferation of cultured cells was measured by assessing BrdU incorporation (Cell proliferation ELISA Kit 11647229001; Roche) after addition of Dox (2µg/ml ...
-
bioRxiv - Immunology 2020Quote: Telomerase activity was assessed with a TeloTAGGG telomerase ELISA kit according to the manufacturer’s instructions (Roche) and extracts of 2 × 103 viable T cells as described previously27.
-
bioRxiv - Molecular Biology 2022Quote: ... DNA fragmentation was evaluated using a Cellular DNA Fragmentation ELISA Kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... HA (rat; Roche), and Sec31 (mouse ...
-
bioRxiv - Cell Biology 2024Quote: ... HA (rat; Roche), Sec31 (mouse ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were stained with Bromodeoxyuridine (BrdU) and assessed with a BrdU ELISA kit (Roche, Mississauga, ON, Canada) following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... Pegylated interferon alpha-2a (PEG-IFN-α; Pegasys, 90 mcg, Roche) was aliquoted and stored at room temperature until further use ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-HA Rat (Roche), anti-Histone H3 Rabbit (Abcam) ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-HA (Roche), 1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... rat α-HA (Roche), mouse α-MYC (Cell Signaling ...
-
bioRxiv - Microbiology 2021Quote: ... rat α-HA (Roche), mouse anti-GFP (JL-8 clone ...
-
bioRxiv - Cell Biology 2021Quote: ... rat-αHA 3F10 (Roche) and rabbit-αSRS9 (100 ...
-
bioRxiv - Physiology 2022Quote: ... hemagglutinin (HA; rat, Roche Diagnostics GmbH ...
-
bioRxiv - Cancer Biology 2021Quote: ... rat anti-HA (Roche 11867423001 ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-HA (Roche) 1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-HA (Roche), 1:500 ...
-
bioRxiv - Genetics 2020Quote: ... rat anti-HA (Roche) and rabbit anti-CID (Active Motif) ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche), goat anti-AC9 (Santa Cruz Biotech) ...