Labshake search
Citations for Roche :
101 - 150 of 7081 citations for Rat Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... anti-HA Ab (rat monoclonal, Roche), anti-CaV2.2 II-III loop Ab (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (1:250; Roche), mouse anti-CD63 (E-12 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-HA (Roche, Basel, Switzerland), mouse anti-GFP (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Rat monoclonal antibody (clone 3F10, Roche) was used to detect HA-tagged proteins ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-HA (1:1000, Roche) The following secondary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... Rat anti-HA antibody (Roche 3F10) was used at 1:2,000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... Rat anti-HA (1:100; Roche), mouse anti-GFP-20 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (1:200, Roche), mouse anti-Flag (1:500 ...
-
bioRxiv - Biochemistry 2021Quote: ... rat anti-HA monoclonal (3F19) (Roche), mouse anti-Dpm1 monoclonal (5C5A7 ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-HA (Roche, 1:1,000) and mouse anti-α-tubulin (12G10 clone ...
-
bioRxiv - Cell Biology 2022Quote: ... and rat anti-HA antibody (Roche). The release to mitosomal proteins was quantified by ImageJ (86).
-
bioRxiv - Immunology 2022Quote: ... rat-anti-HA (clone 3F10, Roche cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-HA (Rat, #11867423001 Sigma Roche), anti-Dan (Rabbit ...
-
bioRxiv - Plant Biology 2023Quote: ... rat α-HA (Hoffmann-La Roche AG ...
-
bioRxiv - Cell Biology 2023Quote: ... rat a-HA (1:2000) (Roche), rabbit anti-aldolase (1.2000 ...
-
bioRxiv - Genomics 2023Quote: ... Rat anti-HA antibody (Roche 3F10) was used at 1:2,000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... HA (11867423001, Roche, rat, 1:1000); HA (sc-7392 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-HA (Roche, rat, 1:1000), anti-Vps18 (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-HA (1:1000, Roche), rat anti-E-cadherin (1:10 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti-HA tag (Roche, 11867432001), rabbit anti-FAM134B (Sigma Prestige ...
-
bioRxiv - Microbiology 2023Quote: ... rat anti-HA (1:2500; Roche), mouse anti-Ty52 (1:10000 ...
-
bioRxiv - Genetics 2024Quote: ... rat anti-HA (Clone 3F10, Roche) at 1:50 ...
-
bioRxiv - Genetics 2023Quote: ... rat anti-HA (Roche, 1:50), mouse anti-C(3)G (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... Wells were pre-coated with 100 μL per well of capture anti-histone antibody contained in the Cell Death Detection ELISA kit (1:40 in 1x coating buffer; Roche 11544675001) or anti-myeloperoxidase (MPO ...
-
bioRxiv - Molecular Biology 2019Quote: ... Apoptosis was measured by Cell Death Detection ELISA (Roche). For reporter assays ...
-
bioRxiv - Immunology 2020Quote: ... cultured in vitro at 30 °C and at 37 °C in EMJH medium was also extracted using a High Pure RNA Isolation kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Then samples were treated at 37 °C for 2 h with 500 µL of RNAse A (Roche) 2 mg/mL and after 30 min with 200 µL of pepsin (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... Pre-hybridization was carried out at 48°C for 2 hours in DIG Easy Hyb buffer (Roche). The trnI/A probe was denaturalized for 20 minutes at 68°C and used for hybridization overnight at 48°C ...
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proliferative activities of VSMCs were quantified by BrdU incorporation using an enzyme-linked immunosorbent assay (ELISA) detecting kit (Roche, Mannheim, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genetics 2021Quote: ... Capture-C libraries were made using the Arima HiC kit (Arima Genomics) and the KAPA HyperPrep kit (KAPA Biosystems) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2019Quote: Rat ventricular myocytes were isolated from adult Sprague-Dawley rats (200 – 250 g) by enzymatic (Liberase™, Roche) digestion (Colecraft et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche, # 11867431001, 1/1000), mouse anti-GFP (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche Cat# 11867423001, RRID:AB_390918), mouse anti-Pan-Neurofascin external (clone A12/18 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (1:200, 3F10, Roche) followed by anti-Rabbit/Mouse/Rat Alexa-dye coupled antibodies (1:400 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-HA (1:50; Roche 3F10), rabbit anti-β galactosidase (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-HA (1:300; Roche 3F10). Luminal chitin was detected using the chitin-binding domain from Bacillus circulans chitinase A1 conjugated with SNAP-Surface AlexaFluor 488 or 563 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-HA rat (Roche, 11867423001; 1:100), anti-Brp mouse (nc82 ...
-
bioRxiv - Neuroscience 2021Quote: ... rat anti-HA (1:500, 11867423001, Roche) or monoclonal mouse anti-GFP antibody (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-HA (Roche 11867423001; 1:1000). Secondary antibodies were selected from the Alexa series (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... rat anti-HA (Roche 3F10, 1:3000), mouse anti-Ty1 (Sigma Clone BB2 ...
-
bioRxiv - Biochemistry 2019Quote: ... Rat-anti-HA 3F10 (1:500; Roche), Mouse-anti-β-actin (1:10,000 ...
-
bioRxiv - Biochemistry 2019Quote: ... Rat anti-HA (Roche, 118667431001, 1:200), Alexa Fluor 594 anti-rabbit (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-HA (1:2,000, Roche, 11867431001), and rabbit anti-HA (1:2,000 ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-HA (1:1000, Roche #11867431001) and mouse anti-GAPDH (1:10,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... and rat anti-HA (1:100, Roche). Secondary antibody used were goat anti-Rabbit Alexa 488 (1:200 ...