Labshake search
Citations for Roche :
401 - 450 of 5647 citations for Rat 3 Hydroxy 3 Methylglutaryl CoA Reductase HMGCR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-HA epitope rat monoclonal (Roche) 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA-clone 3F10 (Roche), mouse anti-Myc monoclonal 4A6 (EMD Millipore) ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche, clone 3F10) (200 pg/ml) ...
-
bioRxiv - Plant Biology 2019Quote: ... rat α-HA (all from Roche), and α-FLAG (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: α-HA rat mAb (1/1,000) (Roche) as primary antibody ...
-
bioRxiv - Synthetic Biology 2021Quote: ... rat anti-HA clone 3F10 (Roche) at a dilution of 1:1000 for SGR57 ...
-
bioRxiv - Microbiology 2021Quote: ... Rat monoclonal antibody (clone 3F10, Roche) was used to detect HA-tagged proteins ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-HA Ab (rat monoclonal, Roche), anti-CaV2.2 II-III loop Ab (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (1:250; Roche), mouse anti-CD63 (E-12 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-HA (Roche, Basel, Switzerland), mouse anti-GFP (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Rat monoclonal antibody (clone 3F10, Roche) was used to detect HA-tagged proteins ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-HA (1:1000, Roche) The following secondary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... Rat anti-HA antibody (Roche 3F10) was used at 1:2,000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... Rat anti-HA (1:100; Roche), mouse anti-GFP-20 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (1:200, Roche), mouse anti-Flag (1:500 ...
-
bioRxiv - Biochemistry 2021Quote: ... rat anti-HA monoclonal (3F19) (Roche), mouse anti-Dpm1 monoclonal (5C5A7 ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-HA (Roche, 1:1,000) and mouse anti-α-tubulin (12G10 clone ...
-
bioRxiv - Cell Biology 2022Quote: ... and rat anti-HA antibody (Roche). The release to mitosomal proteins was quantified by ImageJ (86).
-
bioRxiv - Immunology 2022Quote: ... rat-anti-HA (clone 3F10, Roche cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-HA (Rat, #11867423001 Sigma Roche), anti-Dan (Rabbit ...
-
bioRxiv - Plant Biology 2023Quote: ... rat α-HA (Hoffmann-La Roche AG ...
-
bioRxiv - Cell Biology 2023Quote: ... rat a-HA (1:2000) (Roche), rabbit anti-aldolase (1.2000 ...
-
bioRxiv - Genomics 2023Quote: ... Rat anti-HA antibody (Roche 3F10) was used at 1:2,000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... HA (11867423001, Roche, rat, 1:1000); HA (sc-7392 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-HA (Roche, rat, 1:1000), anti-Vps18 (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-HA (1:1000, Roche), rat anti-E-cadherin (1:10 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti-HA tag (Roche, 11867432001), rabbit anti-FAM134B (Sigma Prestige ...
-
bioRxiv - Microbiology 2023Quote: ... rat anti-HA (1:2500; Roche), mouse anti-Ty52 (1:10000 ...
-
bioRxiv - Genetics 2024Quote: ... rat anti-HA (Clone 3F10, Roche) at 1:50 ...
-
bioRxiv - Genetics 2023Quote: ... rat anti-HA (Roche, 1:50), mouse anti-C(3)G (1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: Cell proliferation was measured by determining the extent of 5-Bromo-2’-deoxy-uridine (BrdU) incorporation into DNA of U87-MG cells using the BrdU cell proliferation assay ELISA kit (Roche, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Wells were pre-coated with 100 μL per well of capture anti-histone antibody contained in the Cell Death Detection ELISA kit (1:40 in 1x coating buffer; Roche 11544675001) or anti-myeloperoxidase (MPO ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Developmental Biology 2021Quote: Tissue samples were minced into small pieces (1-3 mm3) using a scalpel and dissociated with collagenase/dispase (1 mg mL-1; COLLDISP-RO, Roche) in the presence of Rock inhibitor (RI ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2019Quote: ... for 45 seconds at 6,000 rpm x 3 (5 minutes on ice in between intervals) using a Roche Magnalyser instrument (Roche, Germany) and homogenization tubes containing ceramic beads (MagNA Lyser Green Beads ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Microbiology 2019Quote: ... small pieces of cryotissue were homogenized 3 times for 30s at 6500rpm using the MagNALyzer ® instrument (Roche Molecular Systems) with buffer RTL and β-mercaptoethanol (according to the manufacturer’s instructions) ...
-
bioRxiv - Systems Biology 2019Quote: ... 25ml of pre-warmed to 37°C EGTA buffer followed by 25ml of pre-warmed to 37°C EBS buffer with 2.3U of Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) were cannulated into the vena cava ...