Labshake search
Citations for Roche :
301 - 350 of 2472 citations for Rabbit Anti Human IgM Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Biophysics 2020Quote: ... Pyruvate kinase (10109045001) from rabbit muscle was purchased from Roche (Basel, Switzerland). Poly-(dimethylsiloxane ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-proteases cOmplete and anti-phosphatases PhoSTOP were from Roche. Nigericin was from Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... and anti-DIG antibody (Anti-Digoxigenin-AP Fab fragments; Roche), before washing and visualisation ...
-
bioRxiv - Genomics 2020Quote: ... anti-GFP (Roche) and anti-L1 ...
-
bioRxiv - Microbiology 2020Quote: ... anti-HA (Roche, cat#11867423001 ...
-
bioRxiv - Microbiology 2020Quote: ... anti-HA (Roche, cat#11867423001 ...
-
bioRxiv - Cell Biology 2019Quote: ... anti HA (Roche), anti-V5 (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-HA (Roche) conjugated Dynabeads Protein A (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA (Roche), anti-GFP (ab6556 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti GFP (Roche) 1:1000 and anti-Mouse IgG (whole molecule)–Peroxidase antibody (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-HA (Roche), anti-Pol II (Ab26721 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP (Roche, clones 7.1 and 13 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-proteases (Roche)) ...
-
bioRxiv - Plant Biology 2024Quote: ... anti-GFP (Roche), anti-HA (high affinity clone 3F-10 ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-HA (1:10,000; Pierce) or Anti-GFP (1:2000; Roche) served as primary Abs ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-EM48 (1:500; Chemicon) or anti-HA (1:500; Roche) antibodies and developed with biotinylated secondary anti-rabbit (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-GFP (MBL, Japan, 598) and Anti-GFP (Roche, U.S.A., 11814460001) were used for CDRE-GFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... incubating with either anti-digoxigenin or anti-fluorescein-POD antibodies (Roche) diluted at 1:300 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Synthetic Biology 2019Quote: ... and the candidates were PCR amplified from a U2OS (human bone osteosarcoma cell line) genome prep as template with the Kapa Hifi Hotstart Polymerase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity assays were performed as described29 (with minor changes. Proliferation of human cells was assessed using an MTT colorimetric assay (Cell Proliferation Kit I, Roche). HeLa (epithelial cells ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Plant Biology 2024Quote: ... and the immuno-complexes was then analysed on a 10% SDS-PAGE gel using immunoblotting methods with Abcam (Cambridge, UK) anti-GFP and anti-HA antibodies (Anti-HA High Affinity Roche 3F/10 ...
-
bioRxiv - Neuroscience 2021Quote: ... Bound probes were detected with anti-Digoxigenin and anti-Fluorescein antibodies (Roche) and staining was amplified using a TSA staining Kit (Perkin Elmer (NEL0701001KT) ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with anti-TLR7 antibody and anti-HA antibody (Roche) at 37 °C for 90 min ...