Labshake search
Citations for Roche :
601 - 650 of 1715 citations for Puumala Virus Glycoprotein 2 Gc Human Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Blocking was performed in 1xMABT with 2% Blocking Reagents (Roche) and 10% donkey serum (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... 2 mM MgSO4 and protease inhibitor cocktail (Roche cat# 04693132001)) was added and bacteria was incubated on ice for 15 min before centrifugation for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... they were blocked with 2% bovine serum albumin (BSA, Roche). Samples were incubated overnight at 4°C in the same blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with protease and phosphatase inhibitors (Roche) and lysates were sonicated followed by quantification using the Pierce BCA protein assay (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 tablets of cOmplete EDTA-free protease inhibitor cocktail (Roche), 0.1 mg/ml lysozyme ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Microbiology 2023Quote: ... 1% P/S and 50 U/mL IL-2 (Roche), at 37°C and 5% CO2.
-
bioRxiv - Bioengineering 2023Quote: ... Collagenase B solution 2 mg ml−1 B (Roche, Indiana) was used for HUVEC isolation (detailed protocol in 10) ...
-
bioRxiv - Plant Biology 2024Quote: NATA1Δ and NATA2Δ were preincubated with 2 mM acCoA (Roche) and 5 mM of ligands (purchased from Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... and then to MABT with 2% blocking reagent (Roche, 11096176001) at 4°C overnight ...
-
bioRxiv - Physiology 2024Quote: ... 2 × KAPA SYBR FAST qPCR Master Mix Universal (KAPA Biosystems), 5 μl of sample solution ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM benzamidine) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Light Cycler 96 system (Roche, Basel, Switzerland; Exp. 2). The species-specific primer-probe set for each target region of Ayu was shown in Table 1 (see Result) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2 supplemented with protease and phosphatase inhibitor cocktails (Roche)) for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 M NaCl with Complete protease inhibitor tablet (Roche, Indianapolis, IN) and centrifuged for 30 min at 13,000 rpm 4°C to pellet cell debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM EDTA) supplemented with EDTA-free protease inhibitor cocktail (Roche), phosphatase inhibitor (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Plant Biology 2019Quote: ... cOmplete mini protease inhibitor cocktail (2% v/v; Roche Molecular Biochemicals). Before NMR analysis D2O (5% to 10% v/v depending on frequency of spectrometer ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 2 mg/mL of collagenase A (Roche, Basel, Switzerland) and 1× DNase I (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated in blocking buffer (2% blocking reagent (Roche, 11096176001) in 1x TNT ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was permeabilised in 2% Triton-X-100 (Roche, 40319421) in PBS and subsequently incubated in PBSGT blocking solution (0.2% gelatin ...
-
bioRxiv - Systems Biology 2021Quote: ... 2% fatty acid-free bovine serum albumin (BSA) fraction V (Roche), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 mL ready-to-use CDP-Star® (Roche, USA) was added to cover the blot completely ...
-
bioRxiv - Neuroscience 2020Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cartilage explants were incubated with 2 mg/ml pronase solution (Roche) for 90 minutes at 37°C and digested overnight at 37°C in 1.5 mg/ml collagenase B solution (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...