Labshake search
Citations for Roche :
1 - 50 of 3352 citations for Proteasome 26S Subunit Non ATPase 10 PSMD10 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... supplemented with 10 % glycerol and a proteasome inhibitor (Roche) was added ...
-
bioRxiv - Cell Biology 2020Quote: ... containing complete proteasome inhibitor (Roche) and 10 μg/ml PMSF ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5% NP40 containing proteasome inhibitors (Roche). Lysates were analyzed by SDS-PAGE using standard techniques ...
-
bioRxiv - Cell Biology 2020Quote: ... EDTA-free Proteasome Inhibitor Cocktail Tablet (Roche) and phosphatase inhibitor tablet (PhosSTOP EASYpack ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed in cold PBS and incubated on ice in cold swelling buffer (10 mM Tris-HCl pH 8, 10 mM NaCl, 0.2% NP-40, 1 mM AEBSF and 1x complete mini EDTA-free proteasome inhibitor, Roche) for 10 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD45 was stained (clone 2B11&PD7/26, Roche, #5269423001) to identify immune cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... was diluted in Prep kit 26 (783-2876, Roche, Basel, Switzerland) and incubated for 1h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 1 mM AEBSF and 1x complete mini EDTA-free proteasome inhibitor, Roche) and sonicated for 90 min ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were resuspended in 4mL Tris-buffered saline (TBS) containing a cocktail of proteasome inhibitors (EDTA-free, Roche). Cell lysis was achieved by alternately exposing cells to dry ice and absolute ethanol (VWR ...
-
bioRxiv - Neuroscience 2020Quote: ... CAD5 cells were incubated with (0.01%) non-infectious brain homogenate (10% w/v in 0.32M sucrose) to control for efficient proteinase K (PK) (Roche) digestion and to compute the background of the assay ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were pooled by stage and underwent three rounds of centrifugation at 1500rcf at 4°C for 10 minutes followed by rehydration with DPBS with 0.5% non-acetylated BSA and 0.5U/μl RNAse inhibitor (Roche 3335399001).
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... non-EDTA protease inhibitor (Roche, USA) and 100 mM PMSF (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... then lysed on ice for 15 minutes in non-denaturing lysis buffer (150 mM KCl, 10 mM MgCl2, 5mM HEPES, 1% IGEPAL) supplemented with protease inhibitors (Roche Complete EDTA-free ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM DTT, 2 μM MG-132 proteasome inhibitor (#S2619, SelleckChem) and cOmplete® ULTRA EDTA-free inhibitor cocktail (#5892953001, Roche). Approximately 0.1 ml of 0.6 mm glass beads were added and thoroughly mixed ...
-
bioRxiv - Cell Biology 2024Quote: ... and a non-specific protease (Thermolysin; Roche Diagnostics or BP Protease ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were used in MABT/10% horse serum/10% Western Blocking Reagent (Sigma-Roche) at a concentration of 1:2000 for anti-digoxigenin-POD (Sigma-Roche #11207733910 RRID ...
-
bioRxiv - Plant Biology 2023Quote: Proteasome activity was measured by spectrofluorometry using the 7-amino-4-methylcoumarin (AMC)-labeled fluorogenic substrate succinate-LLVY-AMC (Roche Sigma-Aldrich) in cleared extracts of leaf 1 at different dpg (Üstün and Börnke ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were blocked for 1 h with 3% (w/v) non-fat milk powder in PBS/0.1% (v/v) Tween (PBST) (CALR, 10% Roche WBR in PBST) and incubated with primary antibody (Supplementary Table III ...
-
bioRxiv - Pathology 2020Quote: ... Microwave decloaking was performed in 10 mM sodium citrate (pH 6.0) and non-specific sites were blocked in TBSTw containing 1% Blocking Reagent (Roche Diagnostics, Indianapolis, IN), 5% normal goat or donkey sera ...
-
bioRxiv - Microbiology 2022Quote: ... the non-specific competitor Poly dI dC (Roche) was added to each reaction before the probe at a final concentration of 2.5 ng/µl (52) ...
-
bioRxiv - Microbiology 2024Quote: ... the non-specific competitor poly-dI-dC (Roche) was added to the EMSA reactions at a final concentration of 2.5 ng/µL ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Cell Biology 2024Quote: ... samples without (Non reducing) or with 100mM DTT (Roche)(reducing ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were used in TNTx/10% horse serum (Roche, Basel Switzerland) at a concentration of 1:2000 for anti-DIG-POD (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 minute incubation with biotinylated antibody [anti-HA biotin (Roche 12158167001) diluted 1:100 in wash buffer] ...
-
bioRxiv - Zoology 2021Quote: ... a fragment of the EHP small subunit ribosomal RNA (SSU rRNA) gene was used to generate an EHP probe with a PCR-DIG labeling kit (Roche, Germany) ENF779 and ENR779 (Tangprasittipap et al. ...
-
bioRxiv - Synthetic Biology 2021Quote: Non-amyloidal samples were treated with protease inhibitor (Roche complete) before fractions separated and harvested ...
-
bioRxiv - Bioengineering 2020Quote: Western blotting was performed as previously reported.[26] Protein extracts were prepared using RIPA buffer containing EDTA protease (Roche Applied Science) and phosphatase inhibitors (Phostop Roche) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Eurofins Genomics] during 26 to 35 cycles of temperature steps alternating between 95°C and 60°C using a LightCycler 480 (Roche Diagnostics). Amplification yields rec-1 wild-type and mutant alleles of 71 bp and 63 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1.2 μl of KAPA HiFi Non-Hot Start Master Mix (Kapa Biosystems) using 12 amplification cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... and non-fasting glucose concentrations were monitored weekly using Accu-Check glucometer (Roche). Plasma and islet insulin and proinsulin concentrations were measured by commercial ELISA kits (10-1247-01 and 10-1232-01 ...
-
bioRxiv - Genomics 2024Quote: ... to eliminate non-packaged DNA and subsequently with proteinase K (Roche Diagnostics, 03115828001) to digest the viral capsid ...
-
bioRxiv - Genetics 2021Quote: ... 0.1% BSA and incubated with antibodies (10 µL anti-GFP (1:1000, Roche ref:11814460001)/50 µL beads ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated for 10 min at 37°C with anti-HA antibody (3F10; Roche) (1:3000 ...
-
bioRxiv - Biochemistry 2024Quote: ... the membrane was incubated with 10 mL of anti-GFP primary antibodies (Roche, Cat.#11814460001) at a concentration of 1 µg/mL in 4 % milk/TBS-T for 1 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were provided by the Roche Non-Clinical Biorepository from Roche Basel or the Roche-Innovation Center Zurich (RICZ) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were blocked in 5% non-fat milk or 5% Casein (Roche Diagnostics) in Tris-buffered saline with 0.1% Tween (TBS-T ...
-
bioRxiv - Genomics 2022Quote: ... fourteen non-coding regions of interest were PCR amplified from human genomic DNA (Roche) using the Phusion High-Fidelity PCR Kit (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... [U-13C]palmitate was first non-covalently conjugated to ultra fatty acid free BSA (Roche) as previously described (Vacanti et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... the non-specific sites were blocked with 1% Blocking Reagent (Roche, Cat No./ID: 11096176001). The slides were incubated with Anti-Digoxigenin-AP Fab fragment (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... Fasting and non-fasting glucose levels were checked using a glucometer (Roche, Accu-Chek PERFORMA). To assess ketosis ...
-
bioRxiv - Developmental Biology 2022Quote: ... The embryos were then transferred to TBST containing 10% HISS and anti-DIG-AP antibody (Roche, 11093274910) at a dilution of 1:2000 overnight at 4C with constant rocking ...
-
bioRxiv - Genomics 2023Quote: ... (d) Remaining 9/10 of sample is immunoprecipitated with 1:1000 anti-HA antibody (0.1mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Biochemistry 2020Quote: ... Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451) ...
-
bioRxiv - Neuroscience 2023Quote: Cells were lysed in non-denaturing lysis buffer supplemented with EDTA-free protease inhibitor cocktail (Roche) on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated for in donkey anti-mouse FITC antibody diluted in 10 X blocking buffer (1:100; Roche) + 0.3 % Triton-X100 for 1 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...