Labshake search
Citations for Roche :
351 - 400 of 2343 citations for Primary Human Melanocyte Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: Primary neuronal cultures were prepared by dissection of brains from 3rd instar larvae and dissociation of tissue using liberase (Roche). Cells were plated on ConA coated glass coverslips and maintained in Schneiders medium supplemented with 20% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were in contact for 2 hours at room temperature with a mouse monoclonal primary antibody anti-BrdU (1/1000 dilution) (Roche), then rinsed and incubated for 30 min with a fluorescent secondary antibody Alexa-633nm goat anti-mouse (Invitrogen ...
-
bioRxiv - Synthetic Biology 2019Quote: ... or NF-YC3:FLAG was probed with high affinity anti-HA primary antibodies (Roche, catalog no. 11 867 423 001), anti-MYC (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... for 1 hr and incubated overnight with sheep anti-DIG-POD primary antibody (1:1000, for the DIG-labeled probe; Roche) or mouse anti-biotin (1:1000 ...
-
bioRxiv - Genetics 2021Quote: ... each sample was amplified in 6/2 PCR reactions (2 µg DNA/reaction) in the primary/secondary screens using the ReadyMix Kapa polymerase (Roche) with a total of 20 cycles and an annealing temperature of 55°C (Primer sequences in Table S4 ...
-
bioRxiv - Neuroscience 2022Quote: ... brains were incubated with primary antibodies (1:200, chicken anti-GFP, Abeam, Cat# ab13970; 1:200, mouse anti-GFP, Roche, Cat# AB_390913 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indexes and Illumina cluster generation sequences were then added with a secondary PCR reaction using 3 μL of the diluted primary PCR product with a 10 μL Kapa Robust HotStart polymerase reaction (Roche) for 20 cycles ...
-
bioRxiv - Genetics 2023Quote: ... for 30 min at room temperature and incubated for 2 h at room temperature or overnight at 4°C with primary antibodies against GFP (Roche), androgen receptor (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were incubated at 4°C overnight with the primary antibody mouse IgG1 Anti-Tbx6 (home-made, clone A83, dilution 1:500) in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... membranes were blocked with 5% skim milk and then incubated in the primary anti-GFP mouse monoclonal antibody (Roche, 11814460001), followed by goat anti-mouse HRP conjugate (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: Primary antibody incubation with rabbit anti-HA antibody was followed by incubation with OmniMap anti-rabbit HRP (05269679001, Roche Diagnostics). Fluorescence signal was detected with FITC fluorophore (07259212001 ...
-
bioRxiv - Physiology 2023Quote: ... co-staining for Cluster of Differentiation 15 (CD15) antigen was carried out using the CONFIRM Anti-CD15 Mouse Monoclonal Primary Antibody (Ventana/Roche; Roche Diagnostics ...
-
bioRxiv - Physiology 2023Quote: ... co-staining for Cluster of Differentiation 15 (CD15) antigen was carried out using the CONFIRM Anti-CD15 Mouse Monoclonal Primary Antibody (Ventana/Roche; Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by primary antibody labelling (16-120 min) and signal detection carried out with the OptiView DAB IHC Detection Kit (VENTANA/Roche), as described previously (33) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were permeabilised by 10 minutes incubation with 0.1% Triton X-100 on ice and incubated with blocking buffer (10% FBS in 1X PBS) for 90 minutes and then probed with the primary antibody (anti-HA rat 1:100 (Roche) for 2 hours on rotor and after three washing with 1x PBS cells were probed with anti-rat Alex Flour-488 (1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... membranes were incubated with blocking solution (5% skimmed milk in 1X PBS) followed by overnight incubation with respective primary antibodies (anti HA rat 1:1000 (Roche), anti BiP rabbit 1:5000 in cold room and 1 hr incubation with respective secondary antibodies (1:10000 ...
-
bioRxiv - Developmental Biology 2024Quote: Primary tissue samples from reduction mammoplasties of healthy women were dissociated through a 3 mg/mL collagenase (Roche Life Science) solution and sorted via density gradient ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Genomics 2020Quote: ... This was followed with primary antibody incubation performed with 1:1000 goat anti-SOX17 (R&D) diluted with Antibody Dilution Buffer (Roche Ventana) for 60 minutes at 37°C ...
-
bioRxiv - Pathology 2019Quote: ... The slides were incubated in MRPL12 primary antibody (HPA022853, MilliporeSigma) at 1:200 dilution in Antibody Dilution Buffer (ADB250, Roche, Switzerland) for 45 min at RT ...
-
bioRxiv - Plant Biology 2019Quote: ... Blots were blocked for at least 1 hour in blocking solution at RT (5% milk in 1xTBS) before probing with primary antibody in blocking solution (α-HA-HRP, 1:2500 (Roche); α-PGB1 ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactivity in the lung tissues was assessed using a rabbit anti-SARS-CoV-2 Nucleocapsid pAb as the primary antibody (Sinobiological, China) and further processed using a Ventana Discovery Ultra (Roche, USA) system.
-
bioRxiv - Pathology 2020Quote: ... Coverslips were incubated overnight at 4 °C with a 1:100 dilution with one of the following primary antibodies: HA (Roche, #867423001), KDEL (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... Samples were hybridized with digoxygenin-labelled oligonucleotide probes directed to α-globin introns (30 ng per slide) and visualized using FITC-conjugated antibodies (primary: sheep anti-DIG FITC [Roche] 1:50 ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% bovine serum albumin (BSA)/TBS-T ...
-
bioRxiv - Plant Biology 2023Quote: ... Primary and secondary antibody dilutions used for immune detection were as follows: α-HA(rat)-1:2,000 (Roche Diagnostics, Basel, Switzerland), α-GFP(mouse)-1:1500 (Roche Diagnostics ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature and incubated with primary antibodies overnight at 4°C against either HA (1:5000, Roche 12013819001), FLAG (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were gradually washed into SSC buffer and then into PBT before overnight incubation with an anti-DIG primary antibody at 1:5000 (Roche #11093274910). Embryos were washed in PBT and then staining buffer before developing in BM Purple staining solution (Roche #11442074001) ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysates were clarified by centrifugation and then incubated with primary antibodies or HA antibody conjugated beads (HA beads, Roche Applied Bioscience) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... all samples underwent primary PCR amplification (30 cycles) using the conventional V4 primers (515F-806R) and KAPA HiFi Hot Start DNA polymerase (KAPA Biosystems, USA), and secondary PCR was performed to add dual-indexes (IDT ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were separated by SDS-PAGE on 4-12% Bis-TRIS SDS-polyacrylamide gels (Novex, NP0322BOX) and analysis was done against primary antibodies α-HA (1:1000, Roche, 12CA5) or α-Tub2 (1:4500 ...