Labshake search
Citations for Roche :
601 - 650 of 4939 citations for Phthalic Acid Unlabeled 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNase I and 1.5 mg/ml dispase II (all Roche). The LP lymphocyte-enriched population was harvested from a 40%-80% Percoll (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.4 U/ml Dispase II and 1 mg/ml DNAse-I (Roche Diagnostics) in Ca+Mg+ phosphate buffered saline in GentleMACS™ Octo Dissociator with Heaters (Miltenyi Biotec) ...
-
bioRxiv - Immunology 2023Quote: ... digested in R2 buffer containing 0.15mg/ml LiberaseTM and 0.12mg/ml DNAse (Roche) for 45min at 37°C and filtered through 100µm cell strainers.
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Next embryos were washed in blocking solution (100mM maleic acid, 150 mM NaCl pH 7.5, 2% blocking reagent (Roche)) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL digestion mix (4.8 mg/ml Collagenase IV; Worthington Biochem, and 200 μg/ml DNase I; Roche Diagnostics, in 1x PBS) was added after which the tissue was incubated at 37°C for 45 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.25% Triton X-100 and Protease Inhibitor Cocktail (05056489001; Roche)) for 10 min on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP using 1:100 mouse Clones 7.1 and 13.1 (Roche) or 1:200 rabbit anti-GFP polyclonal antibodies generously provided by M ...
-
bioRxiv - Developmental Biology 2019Quote: ... 100 uM ZnCl2 plus EDTA-free Protease Inhibitor Tabs (Roche). Samples were sonicated on ice 1 min at 30% amplitude using a Branson Sonifier and treated with 100 U/ml Benzonase (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... 1.5% Triton X-100 containing phosphatases and proteases inhibitors (Roche). For detection of the Huntingtin protein ...
-
bioRxiv - Microbiology 2019Quote: ... 0.01% TritonX-100) and then treated with RNase A (Roche) at 0.1 mg/mL during 30 min at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% Triton X-100 and 1x protease inhibitor cocktail (Roche). The cell suspension was homogenized ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 % Triton X-100 and protease inhibitor cocktail (Roche complete) on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1% Triton X-100) + 1% SDS + PIC (Roche 05056489001). Sonication was performed in a BioRuptor (Diagenode ...
-
bioRxiv - Cell Biology 2021Quote: ... rat anti-HA mAb clone 3F10 (Roche, 118673230002, 1:100), and chicken anti-GFP pAb (abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% (v/v) TritonX-100 plus Complete Protease Inhibitors (Roche) and 1 mM DTT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.05% TritonX-100) supplemented with protease inhibitors (Complete Mini, Roche), layered gently onto 100 μl of hypotonic buffer containing 30% sucrose and centrifuged at 15,000 g at 4°C for 10 min ...
-
bioRxiv - Genetics 2022Quote: ... 0.2% Triton X-100) plus proteinase inhibitors (PI) (Complete, Roche), sonicated on ice at 80% power for 8 x 30 s on/ 30 s off with a probe sonicator and centrifuged (13,000 rpm for 20 min 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5% Triton X-100) containing protease and phosphatase inhibitors (Roche). After sonication ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% Triton X-100 and cOmplete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1% Triton X-100) with Protease Inhibitor Cocktail (27368400; Roche) and Phosphatase Inhibitor Cocktail (04906837001 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... TritonX-100 (1%) and complete protease inhibitor (Roche, Basel, Switzerland). Cellular lysates were cleared by centrifugation and 300 μg of total protein were incubated with biotin-tagged CIGB-325 (100 μM ...
-
bioRxiv - Microbiology 2021Quote: ... 100 µl of protein G-coupled agarose bead resin (Roche) were washed (2 × CL buffer 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3mM DTT) with 1:100 complete protease inhibitor cocktail (Roche) and centrifuged at 3000 rpm for 1 min at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... Rat anti-HA primary antibody (clone 3F10, Roche, 1:100) was detected with either goat anti-rat conjugated to Alexa Fluor (AF ...
-
bioRxiv - Cell Biology 2019Quote: ... 1% Triton X-100) with protease-and phosphatase inhibitors (Roche). For DNA-bound protein fractions ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 20min on ice ...
-
bioRxiv - Physiology 2021Quote: ... 100 mM ammonium bicarbonate and protease inhibitor (Roche, Penzberg, Germany). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5% Triton X-100) containing protease and phosphatase inhibitors (Roche). After sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5% Triton X-100) supplemented with PMSF and complete (Roche) protease inhibitors ...
-
bioRxiv - Microbiology 2020Quote: ... 1% Triton X-100) containing a protease inhibitor cocktail (Roche).
-
bioRxiv - Cancer Biology 2022Quote: ... 1% Triton X-100) with protease and phosphatase inhibitors (Roche). Protein concentrations were measured using the DC Protein Assay Kit (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... 1% Triton X-100) containing complete proteinase inhibitor cocktail (Roche) and Halt phosphatase inhibitor cocktail (Thermo Fisher Scientific ...