Labshake search
Citations for Roche :
51 - 100 of 723 citations for Phospho Serine Rabbit Polyclonal HRP labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Samples were then incubated overnight at 4°C with a rabbit anti-DIG HRP-conjugate antibody (1:500, Roche). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... Polyclonal anti-GFP antibody (Roche) was used ...
-
bioRxiv - Neuroscience 2019Quote: ... containing protease and phosphatase inhibitors (Phospho-Stop Tablets, Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... and digoxigenin (DIG)-labeled dNTPs (Roche) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and labeled with digoxigenin (Roche, 11175025910). Hybridization was performed with 1 to 5 μg/ml cRNA probes at 65 °C for 20 to 24 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... labeled with digoxigenin-11-dUTP (Roche) was used to localize 35S rDNA sites.
-
bioRxiv - Developmental Biology 2020Quote: ... with Biotin pre-labeled Uridine (Roche) and other reagents according to protocol for T7 RNA polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... and digoxigenin (DIG)-labeled NTPs (Roche) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and Digoxygenin (DIG) labeled dNTP’s (Roche), the resultant RNA cyp19a1 probe was then used for ISH.
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin (DIG)-labeled nucleotides (Roche). In situ hybridization was performed on wildtype and post-electroporation HH11-15 chicken embryos ...
-
bioRxiv - Molecular Biology 2024Quote: ... nuclei were labeled with DAPI (Roche). Immunofluorescence images were acquired using the Zeiss LSM700 confocal microscope with ZEN 2010 software.
-
bioRxiv - Neuroscience 2023Quote: ... antisense digoxigenin (DIG)-labeled riboprobes (Roche) were transcribed with SP6 or T7 RNA polymerase (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 1:500 for 32 min was used followed with the secondary antibody OmniMap anti-rabbit HRP (760-4311, Roche). Antigen-antibody complexes were revealed with ChromoMap DAB Kit (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... 12 minutes incubation with the HRP-conjugated secondary antibody (DISC. Omnimap anti-Ms HRP RUO or DISC. Omnimap anti-Rb HRP RUO, Roche) and 16 minute incubation with the Opal reactive fluorophore (Akoya Biosciences) ...
-
bioRxiv - Bioengineering 2022Quote: ... HRP substrate (Roche, 11582950001) was freshly prepared as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... HRP substrate (Roche, 11582950001) was freshly prepared as follows ...
-
bioRxiv - Microbiology 2020Quote: ... anti-HA HRP (Roche).
-
bioRxiv - Immunology 2021Quote: ... HRP substrate (Roche, 11582950001) was freshly prepared as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... The polyclonal antibodies anti-GFP (Roche), anti-Arp2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by rabbit anti-Rat (AI-4001, Vector) at 1:500 for 32 min and OmniMap™ anti-Rb HRP (760-4311, Roche). Blocking was performed using casein (760-219 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA probes labeled with digoxigenin-UTP (Roche) were synthesized from 1 μg of the above PCR product using the ampliCapTM SP6 high-yield message marker kit (Cell Script).
-
bioRxiv - Molecular Biology 2020Quote: ... Digoxygenin (DIG)-labeled DNA probes (Roche, Germany) were generated by PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and screened it using DIG-labeled (Roche) PCR probes to the center of the FLC locus (primers 5’ AGTGTAACTTCAATGGCAGAAAACCCT 3’ and 5’ ATGTGGCGGTAAGCAGAGATGACC 3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... and digoxygenin- or fluorescein-labeled nucleotides (Roche), and hydrolyzed to around 500 bp if needed ...
-
bioRxiv - Genomics 2019Quote: ... Digoxigenin (DIG) labeled nucleotides (Roche, Basel, Switzerland) were used to create amplified sequences with DIG labeled base pairs ...
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin or fluorescein labeled nucleotides (Roche). In situ hybridization was carried out using standard protocols (74) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled NTPs (11277073910, Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Digoxigenin (DIG)-labeled or fluorescein (FITC)-labeled riboprobes were synthesized with T7 or T3 or SP6 RNA polymerase (Roche) from the linearized plasmids with DIG or FITC RNA labeling mix (Roche) ...
-
bioRxiv - Genetics 2019Quote: ... α-HA-HRP (3F10, Roche), 1:3000.
-
bioRxiv - Biochemistry 2021Quote: ... mAb-HA-HRP (12013819001, Roche), mAb-Flag (F1804 ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-Myc (9E10) HRP (Roche), and anti-V5 (V2260 ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-HA (3F10) HRP (Roche), anti-Myc (9E10 ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-V5 (V2260) HRP (Roche) and anti-FLAG (M2 ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-HA (3F10) HRP (Roche), anti-Myc (9E10 ...
-
bioRxiv - Plant Biology 2023Quote: ... anti-Myc (9E10) HRP (Roche), anti-FLAG (M2 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIG-labeled Arc RNA probes were synthesized with a mixture of digoxigenin-labeled UTP (DIG RNA Labeling Mix, Roche Diagnostics) and purified using Probe quant G-50 Micro columns (GE Healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: Digoxigenin RNA-labeled or Fluorescein RNA-labeled probes were transcribed in vitro using the RNA Labeling Kit (Roche Diagnostics Corporation) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... of antisense digoxigenin-labeled (Digoxigenin-11-UTP, Roche) riboprobes.
-
bioRxiv - Evolutionary Biology 2022Quote: ... using a DIG-labeled NTP mix (Roche diagnostics). The (fluorescent ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and labeled with DIG RNA Labeling Mix (Roche) using previously published protocols74.
-
bioRxiv - Genetics 2019Quote: ... DIG-labeled riboprobes (DIG RNA-labeling kit, Roche) were synthesized using 2 day old wild type embryonic cDNA and gene specific primers with T7 or SP6 overhangs (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... and labeled with DIG RNA label mix (Roche). An anti-DIG antibody conjugated with alkaline phosphatase (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... Sense and antisense Digoxigenin-labeled (DIG-UTP, Roche) riboprobes were prepared by invitro transcription using T3 and T7 RNA polymerases (NEB) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... then labeled with biotin-16-dUTP (Roche, Germany) by nick-translation method (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DIG labeled DNA marker II (Roche 11218590910) was used to determine band size ...
-
bioRxiv - Biophysics 2022Quote: ... were labeled with anti-digoxigenin Fab fragment (Roche) based on a two-step functionalization method described in 67 with the following modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... Probes were labeled with UTP-digoxigenin (11093274910, Roche) and samples incubated at 70 °C in hybridization solution containing 50% formamide ...
-
bioRxiv - Developmental Biology 2022Quote: ... The probes were labeled with digoxigenin (Roche Diagnostics). The ifabp ...
-
bioRxiv - Genetics 2022Quote: ... 5S rDNA labeled with biotin-16-dUTP (Roche) using the PCR-DIG Probe Synthesis Kit (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2023Quote: ... All antisense probes were labeled with digoxigenin (Roche) and detected by BCIP/NBT or BM-Purple (Roche) ...