Labshake search
Citations for Roche :
51 - 100 of 224 citations for Nucleic Acid Stains since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleic acids were UV-crosslinked to the membrane and incubated with prehybridization buffer DIG Easy Hyb (11603558001, Roche,) in a hybridization tube at 37° C for 30 min with rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleic acid precipitation was carried on ice in HisA supplemented with 1M LiCl and cOmplete protease inhibitor (Roche) for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nucleic acid pellet was resuspended TE buffer and treated with 0.05 µg/µL RNase (Roche Cat# 11119915001) for >15 hr at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... they were purified in large volume columns using the High Pure Viral Nucleic Acid Large Volume Kit (Roche) with 2.5 mL of PB buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Microbiology 2021Quote: ... was extracted from inactivated samples (200 μL) using the MagNA Pure Compact instrument and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Molecular Systems Inc ...
-
bioRxiv - Microbiology 2019Quote: ... Sendai Virus (SeV) and Modified vaccinia Ankara (MVA)-gfp viral stocks were extracted using the High Pure Viral Nucleic Acid Kit (Roche). When indicated ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 200 μl of another aliquot of lung homogenate supernatant using the MagNA Pure Total Nucleic Acid Isolation protocol and reagents on a MagNA Pure LC 2.0 instrument (Roche Diagnostics). Prior to extraction ...
-
bioRxiv - Microbiology 2020Quote: ... whole specimens were processed into head/thorax homogenates for RNA extraction with the High Pure Viral Nucleic Acid Kit (Roche), according to manufacturer’s instructions (Moreira et al. ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from homogenized tissue of adenovirus vectored vaccine inoculated mice by High Pure Viral Nucleic Acid Kit (Roche). DNA fragments of Sad23L and Ad49L vectors were amplified by nested PCR with primers specific to adenoviral hexon sequences (Table S4 ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot-blot) or electro transferred (for northern-blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled full-length riboprobes as previously described [8 ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot blotting) or electro-transferred (for Northern blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled riboprobes as previously described (22).
-
bioRxiv - Microbiology 2023Quote: ... and nucleic acid extracted using the MagNA 96 instrument with DNA/Viral NA small volume kits (Roche, Laval, Quebec, Canada). Ophidiomyces ophidiicola was not detected in these samples by qPCR (Allender et al ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 0.05% (v/v) Tween-20) and processed through the spin columns from High Pure Viral Nucleic Acid Large Volume kits (Roche, Switzerland). Purified DNA was eluted in either 45 µl of EB buffer (10 mM tris-hydrochloride (pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA extractions performed at the MPI-SHH substituted the column apparatus from the High Pure Viral Nucleic Acid Large Volume Kit (Roche, Switzerland) in place of the custom assembled Zymo-reservoirs coupled to MinElute (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... three-to-four 5μm FFPE samples sections were taken for RNA extraction using commercial FFPE nucleic acid isolation kit (Roche Molecular Diagnostics). RNA was quantified using Nanodrop and analyzed for fragment distribution using a bioanalyzer (Agilent) ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: Viral RNA was extracted using the MagNA Pure 96 DNA and Viral Nucleic Acid kit on the MagNA Pure 96 system (Roche Diagnostics) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: RNA from specimens from Cyprus underwent automated total nucleic acid extraction using the MagNA Pure 96 DNA AND Viral NA Small Volume kit (Roche Diagnostics). RT-PCR for FCoV was performed at Laboklin Bad Kissingen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... but replaced the Zymo-Spin V column binding apparatus with a high pure extender assembly from the High Pure Viral Nucleic Acid Large Volume Kit (Roche 05114403001). Double-stranded Illumina libraries were prepared using the Blunt-End Single Tube (BEST ...
-
bioRxiv - Genomics 2019Quote: ... trachomatis molecular diagnosis was performed by using a dual-target (chromosome plus plasmid) commercial nucleic acid amplification test (NAAT) (Cobas® 4800 CT/NG from Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The aqueous liquid phase containing the nucleic acids was removed and added to the columns of the High Pure RNA tissue kit (Roche Diagnostics, UK). RNA was purified using repeated wash steps and DNAse treatment ...
-
bioRxiv - Microbiology 2019Quote: ... Nucleic acids from these 200μL mosquito pools and from 100μL venous and finger prick whole blood samples in RNAprotect Cell Reagent were isolated using the bead-based MagNAPure LC automatic extractor (Total Nucleic Acid Isolation Kit—High Performance, Roche Applied Science) and eluted in 50μL of water ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted from the lysate using the Roche MagNA Pure Compact Nucleic Acid Isolation Kit I and the MagNA Pure Compact instrument (Roche, Indianapolis, Indiana). Dual-indexed sequencing libraries were prepared from the lysates using Nextera XT DNA Library Preparation Kit (Illumina FC-131-1096) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were transferred to a high pure extender assembly from the High Pure Viral Nucleic Acid Large Volume kit (Roche, Mannheim, Germany) and centrifuged for 8 min with 1,500 rpm at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System, Laval, QC, Canada) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA levels were determined using gene-specific primers by SYBR green nucleic acid labeling (Selleckchem PCR Mastermix, #B21202) in a Lightcycler 480 (Roche, Indianapolis, IN). Fold change was calculated using the delta delta C(t ...
-
bioRxiv - Genomics 2023Quote: DNA was purified from 200μL Aptima tube specimens using the MagNA Pure Total Nucleic Acid Isolation Kit I (Roche Applied Science, Indianapolis, IN) external lysis protocol on the automated MagNA Pure 24 Instrument and 50µL elution ...
-
bioRxiv - Microbiology 2023Quote: ... the pocks positive for both BleCherry and GFP signals (pocks containing the recombinant green/red virus) were isolated for DNA extraction using High Pure Viral Nucleic Acid Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... DNA isolation was performed with a MagNA Pure LC total Nucleic Acid Isolation kit in the MagNA Pure® system (Roche Diagnostics, Almere, the Netherlands). Samples were tested with a Chlamydiaceae PCR targeting the 23S rRNA and C ...
-
bioRxiv - Developmental Biology 2019Quote: ... and NBT/BCIP stain (Roche). Embryos were mounted in the 3% Methyl cellulose (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Linoleic acid (C18) complexed with fatty acid free BSA (Roche 10775835001). PBS and BSA were used as the vehicle control in experiments containing C8 and C18 respectively ...
-
bioRxiv - Microbiology 2021Quote: ... DAPI stain was added (1:200 dilution of Roche Diagnostics ...
-
bioRxiv - Neuroscience 2022Quote: ... were performed using Ventana BenchMark Special Stains platform (Roche). Sections were scanned using AxioScan.Z1 microscope (Zeiss ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with DAPI stain (0.5 µg/ml, Roche, Basel, Switzerland). Images were acquired using a Zeiss AxioObserver epifluorescence microscope (Oberkochen ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... immunohistochemical staining was performed using an automated Ventana BenchMark Stain System (Roche). Antibodies used were rabbit polyclonal anti-human CD31 (Abcam) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1% deoxycholic acid and protease inhibitors (Roche), and thrice with lysis buffer without detergent ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.5% fatty acid-free BSA (Roche), 10 mg ml-1 Collagenase D (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1% deoxycholic acid with protease inhibitors (Roche). The lysates were subject to anti-GFP immunoprecipitation using GFP-Trap beads or anti-Myc immunoprecipitation using Myc-Trap beads (ChromoTek) ...
-
bioRxiv - Plant Biology 2023Quote: ... ethylenediaminetetraacetic acid free protease inhibitor mixture (Roche) and phosphatase inhibitor mixture (Sigma-Aldrich) ...