Labshake search
Citations for Roche :
101 - 150 of 3519 citations for Neural Precursor Cell Expressed Developmentally Down Regulated 9 NEDD9 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.4 µg vsFULL envelope plasmid using Xtremegene-9 (Roche). After 16 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Cancer Biology 2022Quote: Lentivirus was produced in HEK293T cells using helper plasmids (VSVG and psPAX2) with X-tremeGENE 9 DNA Transfection Reagent (Roche). Target cell lines were infected with the virus and 10 μg/ml polybrene ...
-
bioRxiv - Neuroscience 2021Quote: ... COS-7 cells were plated in 6-well plates (100,000 cells/well) and transfected the next day using X-tremeGENE™ 9 DNA (Transfection Reagent, Roche), with HA-NLGN1 + AP-MDGA1 or AP-MDGA2 + BirAER (1 μg/well) ...
-
bioRxiv - Cancer Biology 2019Quote: ... All viruses were packaged for 48 hours following transfection of HEK-293T cells using X-tremeGENE 9 DNA Transfection Reagent (Roche).
-
bioRxiv - Microbiology 2020Quote: ... 70-80% confluent CHO-K1 cells were transfected in 35 mm dishes using X-TREMEGENE 9 Transfection Reagent (Roche, 6365787001). Each dish was transfected with 2 μg of pCDNA 3.1 Venus plasmid using the using a 3:1 ratio of plasmid to transfection reagent in Opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transfection of pTON-BIOPS-Flag-EGFP-FOXO1/FOXO3 and pCDNA-HA-E2F1 in HEK293T cells was performed using ExtremeGene 9 (Roche). Transfection of siRNA smartpools targeting EMI1 ...
-
bioRxiv - Biochemistry 2021Quote: ... sgRNA expressing vector along with lentiviral packaging vectors Delta-VPR and CMV VSV-G were transfected into HEK-293T cells using the XTremeGene 9 transfection reagent (Roche). Similarly ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK 293 cells stably-expressing GFP-DFCP1 and RFP-ATG9 were generated by transfection of HEK 293 GFP-DFCP1 cell with RFP-ATG9 using X-tremeGENE 9 (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: RPE-1 cells were trans-fected with the different Flag constructs for 48 h using X-tremeGENE 9 DNA reagent (Roche). Cells were lysed in 25mM Tris (pH 7.5) ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral vectors expressing sgRNAs were transfected into HEK293T cells with lentiviral packaging vectors CMV VSV-G and psPAX2 using XtremeGene 9 transfection reagent (Roche). After 24 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... spun down and treated with 0.5-1 ml of RIPA buffer supplemented with protease (Roche) and phosphatase inhibitor cocktail II (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). Virus-containing supernatant was collected 48 hours after transfected and passed through a 0.45μm filter ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA expressing vectors along with lentiviral packaging vectors Delta-VPR and VSV-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001). cDNA expressing vectors along with retroviral packaging vectors Gag-Pol and VSG-G were transfected into HEK293T cells using X-tremeGENE 9 DNA Transfection reagent (Roche #6364787001) ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA- or cDNA-expressing vectors and lentiviral packaging vectors Delta-VPR and CMV VSV-G were transfected into HEK293T cells using XTremeGene 9 transfection reagent (Roche #636478700). The supernatant containing virus was collected 48 h after transfection and passed through a 0.45-µm filter ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant cloned from Flavobacterium meningosepticum and expressed in Escherichia coli) was purchased from Roche Diagnostics (Mannheim ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA transfection was performed using X-tremeGENETM 9 DNA transfection reagent (Roche) in OptiMEM media according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... The transfection was performed using X-tremeGENE 9 DNA transfection reagent (Roche) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral helpers and constructs were transfected using X-tremeGENE 9™ (Roche) according to the manufacturer’s instructions at a 1:3 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche, 6365787001), and 24 h later 5000 GFP+ cells were sorted into a well of six-well plate using mTeSR1 medium supplemented with 10 µM Y-27632 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed using the X-tremeGENE 9 Transfection Reagent kit (Roche) to introduce 1-2 μg of plasmid DNA as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were transfected using X-tremeGENE 9 DNA transfection reagent (Roche, 6365787001) following the manufacturer’s protocol (1 μg plasmid ...
-
bioRxiv - Physiology 2022Quote: ... 150 ng of each plasmid were transfected with X-tremeGENE 9 (Roche) in C2C12 myoblasts immediately after trypsinization (47) ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... two steps of transfections were performed: DNA using XtremeGENE™ 9 (Roche) followed by siRNA (4392420-s30722 ...
-
bioRxiv - Genetics 2024Quote: ... and viral envelope vector gag-pol using XtremeGene 9 transfection reagent (Roche). Collection of viral particles and transduction was performed as described for lentiviral particles ...
-
bioRxiv - Immunology 2024Quote: ... catalog number 2708) using the X-tremeGENE 9 DNA Transfection Reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche Diagnostics). Full-length human TREK-1(TREK-1 FL ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... Expressed proteins were subsequently purified using a cOmplete His-Tag Purification column (1mL column, Roche) and SEC (S200 ...
-
bioRxiv - Plant Biology 2023Quote: ... Differentially expressed transcripts were analyzed with SYBR Green Mix (Roche FastStart Universal SYBR Green Master) and specific primers (Supplementary Table S2) ...
-
bioRxiv - Genomics 2020Quote: ... 2 g of DUX4 expression constructs were transfected into RD cells with 6 L of the X-treme GENE 9 DNA transfection reagent (cat. XTG9-RO, Roche Diagnostics, Indianapolis, USA) diluted in 100 L of Opti-MEM I (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We induced transient expression of the plasmids in 106 cells resuspended in 2 ml using the polymer X-tremeGENE 9 DNA Transfection Reagent (Roche Applied Sciences 06365787001) following manufacturer’s instructions (1 μg total DNA and 3 μl reagent in 100 μl FBS-free culture medium) ...
-
bioRxiv - Neuroscience 2021Quote: Extracts from mouse brain were solubilized in pull-down buffer containing cOmplete™ Protease Inhibitor Cocktail (Roche) and 0.1% saponin for 45 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated overnight with primary antibody α HA antibodies (Roche 3F10) (1:1000 dilution in 20% blocking solution I ...