Labshake search
Citations for Roche :
1 - 50 of 8040 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... (2 mg/kg; atezolizumab, Roche; n = 12). Group 3 received anti-TGF-β I.P ...
-
bioRxiv - Immunology 2021Quote: We used DOTAP (N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate) (Roche) to introduce LPS or oxPLs into cells following the method by Zanoni et al (Zanoni et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 25 uL of N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP) (Roche Diagnostics Deutschland GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Microbiology 2022Quote: ... Two µg plasmid DNA and 25 µL DOTAP (N-[1-(2,3- Dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate) (Roche Diagnostics Deutschland GmbH ...
-
bioRxiv - Immunology 2023Quote: ... Cationic lipid N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate (Dotap, Liposomal Transfection Reagent, Cat#1202375, Roche, Nonnenwald, Penzberg, Germany) was used for the conjugation of phosphorothioated miRNAs and Dotap-formulated miRNAs were used for in vitro delivery of miRNAs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Molecular Biology 2022Quote: ... with modifications - membranes were pre-hybridized in a volume of 0.2ml of pre-hybridization solution (5xSSC, 0.1% N-Lauroylsarcosine sodium salt, 1% SDS, 2% Blocking reagent (Roche)) for each 1cm2 of the membrane ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM EDTA and 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets Roche). Bacterial cells were lysed with a M110-P microfluidizer (Microfluidics ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25% CHAPS, 5 mM ATP, 5 mM MgCl2, 0.25 mM EDTA, 2 mM DTT, 10% glycerol, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cell Biology 2020Quote: Cell viability was determined by MTT (C, N-diphenyl-N′-4,5-dimethyl thiazol-2-yl tetrazolium bromide) assay (Roche, Switzerland), a standard colorimetric assay which uses the metabolic reduction of the tetrazolium salt to form the colored formazan product [33] ...
-
bioRxiv - Immunology 2024Quote: ... Sera were analysed for antibody directed against the SARS-CoV-2 Spike protein receptor-binding domain (S-RBD) and nucleocapsid (N) using an established automated electrochemiluminescence assay (Elecsys Anti-SARS-CoV-2 S and N, Roche diagnostics) [54] ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-DIG-POD (Roche Cat. N: 11207733910, 1:500) and Anti-FITC-POD (Roche Cat ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ...
-
bioRxiv - Neuroscience 2024Quote: 5’-bromo-2’-deoxyuridine (BrdU) (Roche, Indianapolis, IN) was dissolved in 0.9% NaCl and injected intraperitoneally (i.p. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Anti-FITC-POD (Roche Cat. N. 11426346910, 1:500).
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM 2-mercaptoethanol and protease inhibitor cocktail (Roche). The samples were centrifuged at 16,000g for 45 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitor cocktail (Roche) and 2 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... N-glycopeptides were enzymatically deglycosylated and eluted from the beads using 5 U of PNGase F (Roche) in 200 µl of 100 mM NH4HCO3 at 37 °C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM ATP, 1 mM dithiothreitol and protease inhibitor cocktail tablets; Roche) using Bead Beater ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR analysis was performed by mixing 5 μL of 1 μmol·L-1 of both primers and 2.5 μL of 0.25 ng·μL-1 template DNA with 12.5 μL 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The thermal program was 98°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 mM N-ethylmaleimide and Complete protease inhibitor cocktail (Roche, one tablet/10 ml of buffer). HA-tagged ubiquitin was purified using Pierce anti-HA magnetic beads (clone 2–2.2.14) ...
-
bioRxiv - Cancer Biology 2024Quote: ... N-glycopeptides were enzymatically de-glycosylated and eluted from the beads with 5 U of PNGase F (Roche) in 100 mM NH4HCO3 at 37°C overnight ...
-
bioRxiv - Immunology 2021Quote: ... N-Glycans were released by 10 U N-glycosidase F (Roche) digestion in 50 mM NH4HCO3 buffer pH 8.4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... For N-glycan release 2.5 U N-glycosidase F (Roche, DE) were added and the resulting mixture was incubated overnight at 37°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice (n=2 per group) were randomly assigned to receive either diazepam (synthesized by F. Hoffmann-La Roche) 0.3 ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...