Labshake search
Citations for Roche :
51 - 100 of 1090 citations for Myelin Basic Protein Biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... with added biotin-16-UTP (Roche) to generate biotinylated RNA probes.
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... Integration of biotin-16-dUTP (Roche) was performed for 1.5h at 37°C with TdT enzyme (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... or biotin-16-dUTP (Roche, #11093088910) for antibody based detection as previously described or alternatively directly labelled with Green 500 dUTP (Enzo-42845 ...
-
bioRxiv - Cell Biology 2023Quote: ... and Biotin RNA Labeling Mix (Roche), template DNAs were degraded by DNase I (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Genomics 2020Quote: ... DIG-labeled (Roche 11218590910) was used as marker ...
-
bioRxiv - Genomics 2020Quote: ... DIG-labeled (Roche 11218590910) was used as marker for all Southern blot experiments.
-
bioRxiv - Genetics 2022Quote: ... DIG-labeled (Roche 11218590910) was used as the marker.
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche). Subsequent probes were cleaned up using the RNA Clean Up kit (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... or the biotin RNA labeling mix (Roche). For hybridization ...
-
bioRxiv - Cancer Biology 2020Quote: ... amplified with biotin-16-dUTP (Roche, IN). The biotin-labeled probe was detected with IRDye 800CW Streptavidin (LI-COR ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-biotin (1:250 Roche, 1297597), donkey anti-Sheep IgG Secondary Antibody ...
-
bioRxiv - Genomics 2021Quote: ... and biotin RNA labeling mix (Roche 11685597910). Primer sequences are listed in Supplementary Table 1.
-
bioRxiv - Biochemistry 2023Quote: ... 10x Biotin RNA Labelling Mix (Roche, 11685597910), consisting of 10 mM each of ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and biotin RNA labeling mix (Roche 11685597910).
-
bioRxiv - Biochemistry 2019Quote: ... with 35S-labeled methionine (Roche). In vitro translated target proteins were incubated with Flag-tagged Swi6 at 4 °C for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... with Digoxin-labeled Uridine (Roche) and other reagents according to the instructions for T7 RNA polymerase ...
-
bioRxiv - Biochemistry 2021Quote: Digoxygenin-labeled RNA probes (Roche) were generated by in vitro transcription from plasmids containing fragments of murine Shh and Sox9 ...
-
bioRxiv - Plant Biology 2022Quote: ... Digoxigenin (DIG)-labeled NTP (Roche) was integrated into antisense and sense probes during in vitro transcription by T7 polymerase (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and labeled with digoxigenin (Roche). In situ hybridization was performed as previously described (Piacentino et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... Digoxigenin (DIG)-labeled NTP (Roche) was used to label antisense and sense probes generated by T7 polymerase (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl biotin-16-dUTP (Roche 11093070910), and were incubated at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... and Biotin-16-dUTP (Roche Diagnostics, 4 μm) and added to slides for 1 h at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... with either Biotin-16-dUTP (Roche CAT. 11093070910) or Digoxigenin-11-dUTP alkali-stable (Roche CAT ...
-
bioRxiv - Developmental Biology 2023Quote: ... T7 polymerase and biotin labeling mix (Roche #11685597910) were used according to the package directions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The 18S rDNA probe labelled by biotin (Roche) has been prepared from genomic DNA of the slow worm Anguis fragilis ...
-
bioRxiv - Neuroscience 2021Quote: ... in presence of 0.2 mM Biotin-16-UTP (Roche). RNA was purified by adding one volume per sample of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Genomics 2022Quote: ... with digoxigenin 11-dUTP or biotin 11-dUTP (Roche) using the linearised clone pTa71 (from Triticum aestivum ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies (anti-HA biotin conjugate 1:1000 (Roche), mouse anti-RAP148 1:500 ...
-
bioRxiv - Genomics 2019Quote: ... in the presence of Biotin RNA labeling mix (Roche). The primers used were listed in Supplementary Table 3.
-
bioRxiv - Plant Biology 2022Quote: ... biotin-16-dUTP or tetramethyl-rhodamine-5-dUTP (Roche) using BioPrime Array CGH and purified using BioPrime Purification Module (Invitrogen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and digoxigenin (DIG)-labeled dNTPs (Roche) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and labeled with digoxigenin (Roche, 11175025910). Hybridization was performed with 1 to 5 μg/ml cRNA probes at 65 °C for 20 to 24 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... labeled with digoxigenin-11-dUTP (Roche) was used to localize 35S rDNA sites.
-
bioRxiv - Developmental Biology 2019Quote: ... and digoxigenin (DIG)-labeled NTPs (Roche) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and Digoxygenin (DIG) labeled dNTP’s (Roche), the resultant RNA cyp19a1 probe was then used for ISH.
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin (DIG)-labeled nucleotides (Roche). In situ hybridization was performed on wildtype and post-electroporation HH11-15 chicken embryos ...
-
bioRxiv - Molecular Biology 2024Quote: ... nuclei were labeled with DAPI (Roche). Immunofluorescence images were acquired using the Zeiss LSM700 confocal microscope with ZEN 2010 software.
-
bioRxiv - Neuroscience 2023Quote: ... antisense digoxigenin (DIG)-labeled riboprobes (Roche) were transcribed with SP6 or T7 RNA polymerase (NEB) ...
-
bioRxiv - Immunology 2019Quote: ... with both basic (Cell Conditioner 1) and mildly acidic (Cell Conditioner 2) antigen retrieval methods (Roche, Ventana Medical Systems ...
-
bioRxiv - Physiology 2024Quote: The BSEP promoter plasmid based on pGL3-basic (BSEPprom-Luc) was a kind gift from Roche. The human SHP promoter (bases -572 to +10 ...
-
bioRxiv - Microbiology 2022Quote: ... followed by biotin-conjugated anti-rat antibody (Roche, 1:8,000) and then with horseradish peroxidase-conjugated streptavidin (Sigma ...
-
bioRxiv - Physiology 2021Quote: ... pre-hybridized and hybridized with a biotin-16-dUTP (Roche) labeled dsDNA probe including the whole 3’UTR and generated using detailed primers (Bidet et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.5mM biotin-16-UTP (Roche Life Science, Penzberg, Germany) as previously described (37) ...
-
bioRxiv - Microbiology 2023Quote: ... and a biotin RNA labeling mix (cat. no. 11685597910, Roche). To create a 20 μl reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA probes labeled with digoxigenin-UTP (Roche) were synthesized from 1 μg of the above PCR product using the ampliCapTM SP6 high-yield message marker kit (Cell Script).
-
bioRxiv - Molecular Biology 2020Quote: ... Digoxygenin (DIG)-labeled DNA probes (Roche, Germany) were generated by PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and screened it using DIG-labeled (Roche) PCR probes to the center of the FLC locus (primers 5’ AGTGTAACTTCAATGGCAGAAAACCCT 3’ and 5’ ATGTGGCGGTAAGCAGAGATGACC 3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... and digoxygenin- or fluorescein-labeled nucleotides (Roche), and hydrolyzed to around 500 bp if needed ...
-
bioRxiv - Genomics 2019Quote: ... Digoxigenin (DIG) labeled nucleotides (Roche, Basel, Switzerland) were used to create amplified sequences with DIG labeled base pairs ...