Labshake search
Citations for Roche :
101 - 150 of 739 citations for Mouse Whole Genome Microarray since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Whole-cell protein lysates were harvested in lysis buffer (RIPA buffer supplemented with protease inhibitor (Roche), sodium vanadate and sodium molybdate ...
-
bioRxiv - Cell Biology 2020Quote: ... whole cell lysate of primary myoblasts was prepared by lysing buffer containing protease inhibitor cocktail (Roche). Protein concentration was determined with the BCA Protein Assay Reagent (Pierce Biotechnology ...
-
bioRxiv - Genomics 2021Quote: ... and whole transcriptome amplification (WTA) by PCR was performed using KAPA Hifi PCR Mastermix (Kapa Biosystems). WTA product was purified using Agencourt Ampure beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were purified from whole blood or serum using the MagNA Pure 96 system (Roche) with the DNA/Viral NA 2.0 kit and the Viral NA Plasma external lysis S.V ...
-
bioRxiv - Cancer Biology 2023Quote: Whole-cell protein lysates were harvested in lysis buffer (RIPA buffer supplemented with protease inhibitor (Roche), sodium vanadate and sodium molybdate ...
-
bioRxiv - Systems Biology 2023Quote: ... 60 µL whole-transcriptome amplification (WTA) master mix (50 µL 2x KAPA HiFi Hotstart Readymix [Roche #KK2602] ...
-
bioRxiv - Genetics 2020Quote: ... The library was prepared by the Genome Technologies core facility at JAX using Kapa Hyper Prep (Roche Sequencing and Life Science) and SureSelectXT Mouse All Exon V2 Target Enrichment System (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared by the Genome Technologies core service at The Jackson Laboratory using the KAPA RNA Hyper Prep Kit with RiboErase (HMR) (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Whole genome sequencing libraries were generated from 1000 ng of genomic DNA spiked with 0.1% (w/w) unmethylated λ DNA (Roche Diagnostics) and fragmented to 300–400 bp peak sizes using the Covaris focused-ultrasonicator E210 ...
-
bioRxiv - Plant Biology 2019Quote: ... The eDNA was stored at −20°C and sent to the Joint Genome Institute for paired-end sequencing using the KAPA-Illumina library creation kit (KAPA Biosystems) and the HiSeq-2500 Illumina platform (San Diego ...
-
bioRxiv - Neuroscience 2019Quote: ... Libraries were prepared by the Genome Technologies core facility at The Jackson Laboratory using the KAPA mRNA HyperPrep Kit (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Libraries were prepared by the Genome Technologies core facility at The Jackson Laboratory using the KAPA mRNA HyperPrep Kit (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... Libraries were prepared by the Genome Technologies core facility at The Jackson Laboratory using the KAPA mRNA HyperPrep Kit (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: mRNA library preparation was performed by the McGill University and Genome Quebec Innovation Center using the KAPA rRNA-depleted (HMR) stranded library preparation for Illumina sequencing (Roche: 07962282001). Raw RNAseq reads were quality controlled using FASTQC (v0.11.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were then quantified at the Genome Quebec Innovation Centre (Montreal, Quebec) using a KAPA Library Quantification kit (Kapa Biosystems, USA), and average fragment size was determined using a LabChip GX (PerkinElmer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Whole cell extracts were prepared by lysis in RIPA buffer supplemented with protease and phosphatase inhibitors (Roche). Protein concentration was quantified by BCA assay (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... whole mount immunohistochemistry was carried out first using standard procedure that included RNase inhibitor (1:100, Roche) during the blocking steps and used a primary antibody for RFP ...
-
bioRxiv - Cell Biology 2020Quote: Whole cell or mitochondrial samples were lysed in RIPA buffer supplemented with cOmplete protein inhibitor cocktail (Roche) and 1mM phenylmethylsulfonyl fluorid (PMSF) ...
-
bioRxiv - Genomics 2022Quote: Whole cell extracts were prepared by resuspending cells in PBS with complete proteinase inhibitor (Roche, Cat#18970600), centrifugation ...
-
bioRxiv - Immunology 2023Quote: ... minced whole spleens were digested in basal RPMI 1640 supplemented with 25 ug/ml Liberase TM (Roche) and 25 ug/ml DNase I (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... whole transcriptome amplification by PCR was performed for 12 cycles using KAPA HiFi HotStart ReadyMix (Roche, 7958935001) with a PCR primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Neuroscience 2021Quote: ... NeuroMab; HCN2: mouse, 75-111, NeuroMab; HCN3: mouse, 75-175, NeuroMab; HCN4: mouse, 75-150, NeuroMab; HA: mouse, 12CA5, Roche) in 1% milk powder and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... Mouse (Roche) on the LightCycler 2.0 (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1) using Expand High Fidelity PCR system (Roche ref. 11732650001). Primers were design using NEBuilder assembly tool to have 20-basepair (bp ...
-
bioRxiv - Microbiology 2020Quote: ... Pyrosequencing reads provided 55× coverage of the genome and were assembled using the Newbler assembler (version 2.7, Roche 454 Life Sciences, USA) which resulted in 116 contigs across 13 scaffolds ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA of each anti-Thoeris candidate was amplified from the genome of phage SBSphiJ7 using KAPA HiFi HotStart ReadyMix (Roche cat # KK2601) with primers as indicated in Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... were sequenced in the forward direction on 1/8 plate of a 454 Life Sciences Genome Sequencer FLX machine (Roche, Branford, CT) using the Macrogen facilities (South Korea).
-
bioRxiv - Genetics 2023Quote: The DNA of each anti-defense candidate was amplified from the source phage genome using KAPA HiFi HotStart ReadyMix (Roche cat # KK2601). Homologs of verified anti-defense genes were synthesized by Genscript Corp ...
-
bioRxiv - Neuroscience 2024Quote: ... After rebuffering in lactose AAV titers were determined by real-time PCS on vector genomes using the SYBR Green Master Mix (Roche Molecular Systems).
-
bioRxiv - Physiology 2021Quote: ... Whole cell extracts were prepared in HEPES whole cell lysis buffer (20 mM HEPES, pH 7.4, 1% TX-100,1x phosphoSTOP complete inhibition cocktail tablets [Roche] ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatants were obtained from whole livers by homogenization in HBSS supplemented with the complete protease inhibitor cocktail (Roche). Samples were analyzed using Mouse Cytokine Array/Chemokine Array 44-Plex (MD44 ...
-
bioRxiv - Cell Biology 2021Quote: ... Stromal vascular fraction (SVF) cells and mature adipocytes were separated from whole adipose tissue biopsies following collagenase (Roche) digestion (1 mg/ml in Hanks’ buffered salt solution ...
-
bioRxiv - Cell Biology 2021Quote: ... whole cell lysates were obtained by lysing the cells in RIPA buffer containing cOmplete Protease Inhibitor Cocktail (Roche). Following sonication ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Whole cell extracts were prepared in HEPES whole cell lysis buffer (20 mM HEPES, pH 7.4, 1% TX-100,1x phosphoSTOP complete inhibition cocktail tablets [Roche] ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Whole-blood glucose levels were measured using the Accu-check Performa glucometer and accompanying strips (Roche Diagnostics, Canada). For the 6M cohort ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Whole-blood glucose levels were measured using the Accu-check Performa glucometer and accompanying strips (Roche Diagnostics, Canada). During blood sampling from the right lateral tail vein ...
-
bioRxiv - Cell Biology 2022Quote: ... the whole-cell extracts and immunoprecipitates were subjected to western blotting using monoclonal anti-GFP (JL-8, Roche), Flag-M2 monoclonal antibody (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: Whole cell lysates were prepared via scraping cells in PBS containing protease inhibitors (Complete Protease inhibitor cocktail, Roche). Cells were pelleted and resuspended in hot SDS lysis buffer (0.5 % SDS ...
-
bioRxiv - Cancer Biology 2023Quote: Whole slides were scanned at x40 resolution (0.25 um per pixel) on a Ventana DP200 slide scanner (Roche) for chromogenic slides ...
-
Salmonella actively modulates TFEB in murine macrophages in a growth-phase and time-dependent mannerbioRxiv - Cell Biology 2023Quote: ... whole cell lysates were prepared using 2x Laemmli buffer containing phosSTOP and protease inhibitor cocktail (Roche, Mississauga, ON). Lysates were passed through a 27-gauge needle ten times ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was isolated as previously described (Fischer et al., 1999) and analyzed using the Genome Sequencer FLX+ System (GS FLX+; Roche Diagnostics, Basel, Switzerland), Genome Analyzer GAIIx (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: Genome-wide methylation analysis was performed using the Roche SeqCap Epi Developer M Enrichment system on bisulfite-treated DNA (Roche Nimblegen; WI, USA), with custom designed primers targeting promoter and enhancer regions of the genome ...
-
bioRxiv - Genetics 2022Quote: Southern blot analysis was performed to ensure that the foreign gene Bar was present in randomly excised segments of the T2 transformed soybean genome by following the protocol from the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche, Indianapolis, IN, USA). DNA was extracted from the plants with positive PCR results ...
-
bioRxiv - Neuroscience 2023Quote: ... The physical vector titers were quantified by measuring the number of packaged vector genomes by real-time PCR using SYBR Green reaction mix (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... and thiamine-dependent repression was validated by immuno blotting of whole cell extracts using anti-HA antibodies (Roche, 3F10).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The imaginal discs were removed and suspended whole in 350μl of sucrose solution (250mM D-sucrose, 10mM Tris-HCl, 1mM. MgCl2, 1x protease inhibitors (Roche)) inside labelled 2ml dounce homogenisers (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... In situ hybridization signals in whole-mount embryos were detected using anti-DIG alkaline phosphatase (AP)-conjugated antibody (Roche) with an AP substrate ...
-
bioRxiv - Biochemistry 2020Quote: ... We typically used 23 nM of SCR1 or actin RNA and 0.14 µg/µl of whole yeast RNA (Roche) that was purified on a DEAE-Sepharose column to remove inhibitors ...
-
bioRxiv - Microbiology 2019Quote: ... Whole cell extracts were prepared after transfection and incubated with indicated antibodies together with Protein A/G beads (Roche) overnight ...