Labshake search
Citations for Roche :
51 - 100 of 7176 citations for Mouse Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3h at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... the slides were incubated for 5 h at 8°C with mouse anti-DIG antibody (Roche, Basel ...
-
bioRxiv - Cancer Biology 2022Quote: The activity of telomerase in the cell lines was detected using the TeloTAGGG telomerase PCR ELISA Kit (Roche, Cat# 12013789001). The assay was performed according to the manufacturer’s instructions and repeated in triplicate ...
-
bioRxiv - Molecular Biology 2022Quote: ... Hi-C libraries were prepared using KAPA LTP Library Preparation Kit (Roche) 65 with 12 amplification cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 µg of 330-BFP-CYP3A4-enhancer-R-sgRNA were transfected with X-tremeGENE 9 DNA transfection reagent (Roche 6365809001). After 3-5 days ...
-
bioRxiv - Molecular Biology 2022Quote: ... The clarified lysate was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3 h at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Collected media was incubated for 2 hours at 55°C with 20mg/ml proteinase K (Roche). Then ...
-
bioRxiv - Immunology 2023Quote: ... Wells were pre-coated with 100 μL per well of capture anti-histone antibody contained in the Cell Death Detection ELISA kit (1:40 in 1x coating buffer; Roche 11544675001) or anti-myeloperoxidase (MPO ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse/rabbit IgG overnight at 4°C and further with protein G-coupled agarose beads (ROCHE) for 1-2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... Apoptosis was measured by Cell Death Detection ELISA (Roche). For reporter assays ...
-
bioRxiv - Immunology 2020Quote: ... cultured in vitro at 30 °C and at 37 °C in EMJH medium was also extracted using a High Pure RNA Isolation kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Then samples were treated at 37 °C for 2 h with 500 µL of RNAse A (Roche) 2 mg/mL and after 30 min with 200 µL of pepsin (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... Pre-hybridization was carried out at 48°C for 2 hours in DIG Easy Hyb buffer (Roche). The trnI/A probe was denaturalized for 20 minutes at 68°C and used for hybridization overnight at 48°C ...
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proliferative activities of VSMCs were quantified by BrdU incorporation using an enzyme-linked immunosorbent assay (ELISA) detecting kit (Roche, Mannheim, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genetics 2021Quote: ... Capture-C libraries were made using the Arima HiC kit (Arima Genomics) and the KAPA HyperPrep kit (KAPA Biosystems) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... The membrane was incubated overnight (O/N) at 4°C with mouse anti-α-tubulin (Roche, loading control) at 1:4000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated using a KAPA Mouse Genotyping Kit (Roche). PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs ...
-
Precision genetic cellular models identify therapies protective against endoplasmic reticulum stressbioRxiv - Neuroscience 2020Quote: ... DNA was extracted by the KAPA Mouse Genotyping Kit (KAPA Biosystems) and genotyped by Sanger sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR analyses confirmed mouse genotypes with DNA isolated from ear biopsies using the KAPA Mouse Genotyping Kits (Kapa Biosystems). All PCR primers are listed in Supplementary Table 1.
-
bioRxiv - Developmental Biology 2023Quote: Genotyping of ESCs and mouse tails were performed by PCR using KAPA Mouse Genotyping Kit (Roche, Cat. No. KK7302). Specific protocol followed the reagent instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CAT expression was quantified using the CAT ELISA (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking Reagent for ELISA (BRE) (11112589001) was manufactured by Roche. 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking reagent for ELISA (BRE, cat. 11112589001) was from Roche. DC Assay kit was from Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested for 30 minutes at 37 °C in DMEM + 2 mg/mL Collagenase A (Roche, Basel, Switzerland) + DNase (Roche ...
-
bioRxiv - Genomics 2019Quote: ... Probes were bound to 2 µg nuclear extracts pre-incubated with 1 µg poly d(I-C) (Roche) or 100-750ng YY1 full-length recombinant protein (31332 ...
-
bioRxiv - Genomics 2023Quote: ... treated at 55°C and then pre-cleared with 1:2 KAPA Pure beads (Roche Cat. No: 07983298001). The quality and quantity of fragmented DNA were verified using agarose gel (1.5% ...
-
bioRxiv - Plant Biology 2020Quote: ... roots were incubated overnight at 4°C in anti-myc-mouse primary antibody (1:250, Roche in blocking solution), washed 3 times in PBST ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were incubated overnight at 4°C with monoclonal mouse anti-GFP antibody (Roche; Basel, CH; dilution 1:500) or monoclonal rat anti-HA antibody (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Genotyping of mice was performed using a mouse genotyping kit (Kapa Biosystems). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... Genotyping of mice was performed using a mouse genotyping kit (Kapa Biosystems). Briefly ...
-
bioRxiv - Immunology 2021Quote: ... Lungs were dissected and digested for 30min at 37°C using RPMI media (2% FBS+ Pen/Strep, glutamine, 10mM HEPES) containing 0.5mg/mL Collagenase D (Roche). The digested fragments were passed through a 70μm cell strainer (Greiner bio-one ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed three times 15 min each in PBST and pre-incubated for 1h at 60°C in Hybridization Buffer (HB: 50% Formamide, 2X SSC, 1mg/ml Torula RNA, 0.05mg/ml, Heparin, 2% Roche blocking reagent ...
-
bioRxiv - Genetics 2023Quote: ... incubated the islets for 10 min at 37°C in 2 mL PBS with 4U Dispase I (Roche Diagnostics) / 2U DNase I (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... we used a cell death detection ELISA (Roche Molecular Systems, Inc.), which is an analytical quantitative sandwich enzyme immunoassay technique that uses the interaction the mouse monoclonal antibodies with DNA and histone to detect internucleosomal fragmented DNA ...
-
bioRxiv - Cell Biology 2019Quote: Cells proliferation was assessed by BrdU Cell proliferation ELISA from Roche. IL-6 ELISA was from Affimetrics ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was evaluated using a colorimetric Cell Proliferation ELISA (Roche), based on the measurement of the incorporation of bromodeoxyuridine (BrdU ...
-
bioRxiv - Immunology 2020Quote: ... 30 μl/well of BM Chemiluminescence ELISA substrate (Roche, 1:50) was added to the plate ...
-
bioRxiv - Biochemistry 2023Quote: Cell proliferation was determined using a colorimetric Cell Proliferation ELISA (Roche) kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... cv-c riboprobe was marked using DIG RNA Labelling Kit (Roche, 11 175 025 910). Images were taken on an SPE Leica confocal microscope and processed using FIJI and Adobe Photoshop programs.
-
bioRxiv - Cell Biology 2020Quote: ... bovine serum albumin in TBS-T and incubated for 16 h at 4°C: mouse anti-GFP (1:1000) (Roche), sheep anti-CK1α (1:100 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the soluble fraction was incubated for 1 h at 4°C with beads crosslinked to mouse anti-GFP antibody (Roche). Resulting Immunoprecipitates were washed three times with lysis buffer and protein eluted with RapiGest surfactant (Waters ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-Green Fluorescent Protein overnight at 4°C (Clones 7.1 and 13.1; 1:50 dilution, Roche, Mannheim, Germany) and rat monoclonal anti-HA High Affinity for 60 minutes at room temperature (clone 3F10 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... lower and upper mouse and hamster first molars were dissected as above and treated for 15 minutes at 37°C with Dispase (Roche) 10mg/ml in Hepes/KOH 50mM ph7.7 ...