Labshake search
Citations for Roche :
451 - 500 of 837 citations for Mouse ONECUT3 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and packaging plasmids PEx-QV and pMD-G were co-transfected into HEK 293T cells using Fugene 6 (Roche). After 4 days ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids and ssDNA were transfected into hESC_H1 (WiCell) of 70-85% confluency using the XtremeGENE 9 transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Two µg plasmid DNA and 25 µL DOTAP (N-[1-(2,3- Dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate) (Roche Diagnostics Deutschland GmbH ...
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 200 ng of plasmids for 48 h using X-tremeGENE 9 DNA reagent (Roche, Fig. 2A), or electroporated with 2 μg of plasmid using Lonza’s nucleofection protocol (Fig ...
-
bioRxiv - Cell Biology 2022Quote: ... S3C) or 120 ng of plasmid for 24h (Fig. 3E) for 24h using X- tremeGENE 9 DNA reagent (Roche).
-
bioRxiv - Cancer Biology 2022Quote: ... DF1 cells were transfected with the indicated RCAS plasmid using X-tremeGENE 9 DNA transfection reagent (Roche, Catalog# 06365809001) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: Pax6a digoxigenin (DIG) antisense RNA probes were generated from linearised plasmids using an RNA labelling and detection kit (Roche) (Scholpp and Brand ...
-
bioRxiv - Microbiology 2022Quote: ... 1.5 million S2 cells were transfected with 2 μg of plasmid using Xtreme-GENE HP DNA transfection reagent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and transfected with the indicated plasmid 48 to 72 hrs prior to imaging using X-Treme gene HP (Roche) transfectant reagent according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sense and antisense riboprobes were transcribed from linearized plasmids and labeled with digoxigenin (DIG RNA-labelling reagents, Roche Biochemicals). Primers used to amplify zebrafish nhsb were 5’ tgatctaccttttctcccatgccatt 3’ and 5’ tctcacacaccacagaggctcca 3’ ...
-
bioRxiv - Genetics 2020Quote: ... and one day later 2 micrograms of plasmid DNA was transfected into cells using Xtremegene HP transfection reagent (Roche) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... and 0.8 μg of a EF1α promoter-transfer plasmid with 9 μl X-tremeGENE 9 or HP (both Roche). Lentiviral supernatant was harvested after 20–30 h and filtered through a 0.45 μm cellulose acetate filter ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were cotransfected with 4 μg of Env-deficient HIV-1 proviral plasmid (Q23ΔEnvGFP) and 2 μg of HIV-1 Env clone of interest using Fugene 6 transfection reagent (Roche) following manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... Cells were plated on six-well culture plates at 50% confluency and then transfected with 1 μg/well of the expression plasmid (pCDNA3.1-hTau441) using X-tremeGENE9 DNA transfection reagent (Roche). Cells were transferred to a 10-cm dish containing 300 μg/ml gentamycin-disulfate (G418 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... was introduced by site directed mutagenesis on C-terminal SNAP-tagged H3.1 (HIST1H3C coding sequence cloned in pSNAPm) and H3.3 (H3F3B coding sequence cloned in pSNAPm) encoding plasmids with a PCR master kit (Roche) and the primers indicated in Supplementary table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid minigenes were transfected 24 h after cell seeding using X-tremeGENE 9 DNA Transfection Reagent (Roche; Mannheim, Germany). HepG2 ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasmid backbones and DNA fragments were amplified using the KAPA HiFi HotStart PCR kit (Kapa Biosystems, Boston, USA) and the primers described in Table S3 ...
-
bioRxiv - Neuroscience 2024Quote: ... The template plasmid was diluted to 5×107 copies/µL with nuclease-free water plus yeast RNA (Roche, 10109223001), and this solution was further diluted to 2.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... containing 25 ng/mL mouse anti-HA antibody conjugated with peroxidase (Roche, 12013819001) and 4% non-fat skim milk ...
-
bioRxiv - Genetics 2021Quote: ... Two corneas (per mouse) were incubated in 15 mg/ml Dispase (4942078001, Roche) in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary antibodies used in this study are as follows: mouse anti-GFP (Roche) and mouse anti-Actin (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) was used in the immunostaining assay.
-
bioRxiv - Neuroscience 2021Quote: ... or anti-GFP mouse monoclonal antibody (1:200, 11814460001, clones 7.1, 13.1, Roche), respectively ...
-
bioRxiv - Biochemistry 2021Quote: ... 4A the following antibodies were used: mouse anti-HA 12CA5 1:1000 (Roche), rat anti-HMR 2C10 1:25 (Helmholtz Zentrum Munich) ...
-
bioRxiv - Synthetic Biology 2021Quote: The primary antibodies used were mouse anti-GFP (clones 7.1 and 13.1) (Roche) at a dilution 1:5000 for SGR57 and SGR58 ...
-
bioRxiv - Plant Biology 2020Quote: ... Primary antibodies were α-GFP (mouse) and α -HA (rat; both from Roche), α –EDS1 (Rabbit ...
-
bioRxiv - Plant Biology 2021Quote: ... that had been pre-conjugated with a monoclonal mouse anti-GFP antibody (Roche) at room temperature for 2 h ...
-
bioRxiv - Genomics 2022Quote: ... incubated with anti-DIG1 (mouse anti-digoxigenin, 1:100, Roche Diagnostics, Basel, Switzerland) and streptavidin Cy3 conjugate (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Immunoblotting followed established protocols using mouse anti-HA monoclonal antibody (1:1,000) (Roche). Detection was done using the Odyssey Clx LICOR system using goat anti-mouse IRDye800WC (1:10,000) ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected with primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:1000 and rabbit α-PfHP1 12 ...
-
bioRxiv - Cell Biology 2020Quote: ... The oocytes were immunostained with anti-GFP mouse antibody (1:200 dilution; Roche) followed by anti-mouse IgG-Alexa Fluor 488 antibody (1:200 dilution ...
-
bioRxiv - Plant Biology 2019Quote: ... Western blotting was carried out using mouse anti-GFP 11814460001 (Roche, Basel, Switzerland) and rabbit anti-Histone H3 AS10710 (Agrisera ...
-
bioRxiv - Cell Biology 2019Quote: GFP-Pav and Tum proteins were incubated with mouse anti-GFP antibody (Roche) overnight at 4°C ...
-
bioRxiv - Genetics 2019Quote: ... Primary antisera and dilutions were: mouse anti-HA monoclonal (clone 12CA5, Roche; 11583816001), 1/10,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-HA was from Covance (Suffolk, UK; mouse monoclonal MMS101P) or from Roche (Wellwyn Garden City ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies used in Western blot analysis: monoclonal α-GFP (1:1000; mouse; Roche), α-GAPDH (1:3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... For3-GFP fusions were detected with a mouse monoclonal anti-GFP antibody (Roche), with anti-cdc2 (PSTAIR ...
-
bioRxiv - Microbiology 2022Quote: ... and mouse anti-GFP in a dilution of 1:1000 (α-GFP, ROCHE). For all primary mouse antibodies an anti-mouse-HRP in a dilution of 1:2000 was used (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HA (12CA5, Mouse mAb, cat# 11583816001, Roche, at 1 μg/mL final concentration); MTA2 (Rabbit polyclonal antibody ...
-
bioRxiv - Cell Biology 2023Quote: Antibodies were applied in the following dilutions: mouse a-GFP (1:1000) (Roche), rat a-HA (1:2000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then exposed to mouse anti-digoxigenin antibody (Roche, #11333062910; 1/100 dilution) or rabbit anti-fluorescein antibody (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Molecular Biology 2023Quote: Mouse aortic arches were incubated in digestion buffer containing liberase (Cat. # 273582, Roche), hyaluronidase (Cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used in this study were mouse anti-BrdU antibody (11170376001, Roche), goat anti-GFP (ab6658 ...
-
bioRxiv - Developmental Biology 2023Quote: ... All genotyping reactions were performed with KAPA HotStart Mouse Genotyping Kit (Roche, 07961316001) with 1 μL of gDNA and a final primer concentration of 5 μM each ...
-
bioRxiv - Cell Biology 2020Quote: hESC H9 cell line was transfected with 2ug of pB-CAG-Dest-pA-pgk-bsd-CENP-A-SNAP plus 2ug of pBASE plasmid (harbouring the piggybac transposase, kind gift from José Silva) using FuGeneHD (Roche), in a ratio of DNA:FuGene of 1:3 ...
-
bioRxiv - Cell Biology 2019Quote: ... Riboprobe synthesis for WISH was carried out with the linearized plasmid using digoxigenin (DIG) RNA labelling mix and T7 RNA polymerase (Roche) according to manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... 1.0 × 106 THP-1 cells were transfected with mixture of two sgRNAs-expressing plasmids (0.5 µg each) using X-tremeGENE™ 9 DNA Transfection Reagent (6365779001, Roche) according to manufacturer’s manual ...