Labshake search
Citations for Roche :
301 - 350 of 7568 citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... In Situ Cell Death Detection kit (Roche Cat# 11684795910) was used to assess cell death.
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.25 μM gene-specific primers and 5 μl LightCycler 480 SYBR Green I Master (Roche) on a Roche LightCycler 480 II real-time PCR System according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MpC1HDZ was amplified from cDNA using a specific forward primer and polyT reverse primer (Roche) and ligated into pGEMT ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). Cq values of non-housekeeping genes were normalized to RHOA or b-ACTIN expression ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates sampled with phospho-specific antibodies were also lysed with phosphatase inhibitors (phosSTOP™, Roche). Lysates were then centrifuged at 20,000 g ...
-
bioRxiv - Immunology 2022Quote: ... 200 nM specific TaqMan probe (TM) and the LightCycler® Multiplex RNAVirus Master mix (ROCHE). The programs were ...
-
bioRxiv - Genomics 2022Quote: ... to assess their size distribution and quantified by qPCR with adapter-specific primers (Kapa Biosystems). Libraries were pooled together based on expected final coverage and sequenced across multiple flow cell lanes to reduce the effect of lane-to-lane variations in yield ...
-
bioRxiv - Immunology 2019Quote: ... Gene-specific oligonucleotides (Supplementary Table I) were designed using the Universal ProbeLibrary software (Roche Diagnostics). Results were expressed relative to the expression level of the endogenous reference gene TBP and using the ΔΔCT (cycle threshold ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). RHOA expression was used as a housekeeping gene for the normalization of non-housekeeping gene expression ...
-
bioRxiv - Immunology 2020Quote: ... using V gene-specific primers 18 and KAPA Biosystems (KAPA HiFi HotStart, Roche, Basel, Switzerland). The PCR conditions were as follows ...
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Biophysics 2023Quote: ... gene-specific oligonucleotides (Supplementary Table 14) and analyzed using the LightCycler480™ system (Roche Diagnostics). We calculated mRNA expression levels relative to the housekeeping gene Hypoxanthine Phosphoribosyltransferase 1 (HPRT).
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche #06402712001). Cq values of genes of interest were normalized to housekeeping gene RHOA expression.
-
bioRxiv - Cancer Biology 2022Quote: Total proteins of cells were extracted using RIPA lysis buffer (Beyotime) with Protease Inhibitor (Roche) and Phosphatase Inhibitor (Roche) ...
-
Small Molecule Screen Identifies Pyrimethamine as an Inhibitor of NRF2-driven Esophageal HyperplasiabioRxiv - Cancer Biology 2022Quote: ... The cell lysate was pre-cleaned with protein G agarose beads (Roche Diagnostic, Basel, Switzerland) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Blocking reagent for ELISA (BRE) and cOmplete protease inhibitor tablets were from Roche (Basel, Switzerland). Phosphate buffered saline (PBS ...
-
bioRxiv - Genomics 2021Quote: ... 100uL of the clarified supernatant was used in the anti-BrdU DNA fragmentation ELISA (Roche). Each condition was tested in technical triplicates ...
-
bioRxiv - Cell Biology 2020Quote: ... mitochondria were resuspended in 1 ml solution B containing protease inhibitor (PI; Roche) and incubated with anti-TOM22 microbeads on a rotary wheel for 30 mins at 4 °C ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... 2% b-mercaptoethanol) and cOmpleteTM mini EDTA-free protease inhibitor cocktail (Roche, #04693159001) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... NeuroMab; HCN2: mouse, 75-111, NeuroMab; HCN3: mouse, 75-175, NeuroMab; HCN4: mouse, 75-150, NeuroMab; HA: mouse, 12CA5, Roche) in 1% milk powder and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: DNA was extracted from mouse ear biopsies using High Pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: DNA was extracted from tail or ear clippings using the Kapa Mouse Genotyping Standard kit (KAPA Biosystems) and stored at -20°C ...
-
bioRxiv - Molecular Biology 2024Quote: Genomic DNA (gDNA) was isolated from mouse ear punch biopsies using the PCR Template Preparation kit (Roche). Targets was PCR amplified using Taq Polymerase (Roche ...
-
bioRxiv - Immunology 2021Quote: ... Mouse (Roche) on the LightCycler 2.0 (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell survival relative to vehicle-treated cells was assessed using the WST-1 kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: The cell proliferation assay was carried out using WST-1 Cell Proliferation Assay Kit (Roche). Transfected cells were seeded into 96-well plates at a density of 1 × 103 cells/well ...
-
bioRxiv - Cell Biology 2021Quote: Apoptotic cell analysis was performed using an in situ Cell death detection Fluorescein kit (Roche). Formalin-fixed ...
-
bioRxiv - Cell Biology 2022Quote: ... cell viability was determined using the XTT cell proliferation kit II (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Cell death was assessed using TUNEL staining from In Situ Cell Death Detection Kit (Roche) with Opal-based costain for sarcomeric actin as described above ...
-
bioRxiv - Physiology 2023Quote: ... Cell death was detected using an In Situ Cell Death Detection Kit (Roche, catalog # 12156792910). CD63 and ALP double positive (CD63+ ...
-
bioRxiv - Neuroscience 2023Quote: ... cell viability was measured using the Cell Proliferation Kit I (MTT) (Roche Applied Science, CH) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell apoptosis was detected by TUNEL assay with In Situ Cell Death Detection Kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Cell viability staining was performed using the In situ cell death detection kit (Roche Diagnostic). In summary ...
-
bioRxiv - Cancer Biology 2020Quote: Whole-cell protein lysates were prepared by lysing cells in Radioimmunoprecipitation assay buffer (RIPA) supplemented with cOmplete Protease inhibitor (Roche, Basel, Switzerland) and PhosphStop (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: Total protein cell extracts were obtained by lysing the cells with RIPA buffer supplemented with 1x protease inhibitors (PI) (Roche, Milan, Italy). Proteins were quantified using the BCA method (Pierce ...
-
bioRxiv - Cancer Biology 2022Quote: Whole-cell protein lysates were prepared by lysing cells in Radioimmunoprecipitation assay buffer (RIPA) supplemented with cOmplete Protease inhibitor (Roche, Basel, Switzerland) and PhosphStop (Roche) ...
-
bioRxiv - Plant Biology 2019Quote: The satellite-specific probes were labelled by PCR in the presence of biotin-16-dUTP (Roche). We used nick translation to mark the probes for the ribosomal genes ...
-
bioRxiv - Neuroscience 2020Quote: ... we used gene-specific primers and Light Cycler® 480 SYBR Green I Master (Roche Diagnostics). Polymerase chain reaction conditions were as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... We performed targeted RT-qPCR on specific plant transcripts in a LightCycler (LightCycler 480; Roche Diagnostics) as previously described (Girin et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... using gene-specific digoxigenin-nucleotide-labelled DNA probes (Digoxigenin-11-dUTP alkali-labile, Roche, Basel, Switzerland) obtained using the same primer pairs and conditions as for the PCR ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time amplification was carried out using gene-specific primers and SYBR Green Master mix (Roche) on a Lightcycler LC480 apparatus (Roche ...
-
bioRxiv - Synthetic Biology 2020Quote: ... specific mutations were introduced to the DNA polymerase gene by site-directed mutagenesis (Roche Sequencing Solutions) to enhance the kinetic properties of the polymerase utilizing polynucleotide tagged nucleotides to approach native nucleotide incorporation characteristics32 ...
-
bioRxiv - Physiology 2020Quote: ... Eluted DNA was amplified with specific primers (Table S2) using SYBR Green Master (Roche, Basel, Switzerland), and the resulting signals were normalized to input activity.
-
bioRxiv - Molecular Biology 2022Quote: ... One set specific to the GFP region includes the Universal probe library (UPL) probe #67 (Roche), the forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed using specific primers and the LightCycler 480 SYBR Green I (#04887352001, Roche) on a LightCycler 480 (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Duplicates of cDNA samples and specific primers were mixed with Lightcycler SYBR Green I Master (Roche). Reactions were carried out on a Lightcycler 480 Instrument II (Roche).
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed with specific primers (Table S2) and LightCycler 480 SYBR Green I Mastermix (Roche) using the LightCycler 480 II real-time PCR device (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Enrichment of the specific histone mark was quantified by qPCR using SYBR Green Master Mix (Roche) and qPCR primers 1.4 kb away from the DSB (3xp3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Duplicates of cDNA samples and specific primers were mixed with Lightcycler SYBR Green I Master (Roche). Reactions were carried out on a Lightcycler 480 Instrument II (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... interleukin-2 (IL-2; specific activity 10 U/ng) at concentration of 20 ng/mL (Roche) and phytohemagglutinin (PHA ...