Labshake search
Citations for Roche :
251 - 300 of 6510 citations for Mouse Histone H3.3C H3 5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Roche, # 11814460001) at 1:3000 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Myc (Roche, #11667149001) at 1:200 and rat anti-tubulin (Serotec ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Roche, # 11814460001) at 1:100 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μg of trypsin (Roche, Switzerland) was added and the mixture was further incubated at 37°C overnight ...
-
bioRxiv - Immunology 2019Quote: ... and 5 tablets PhosSTOP inhibitor (Roche) per 50 mL buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... dispase (5 U ml−1; Roche), and deoxyribonuclease II (50 mg ml−1 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 mg/kg midazolam (Dormicum, Roche) and 0.05 mg/kg fentanyl (Fentanyl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then 5 μl proteinase K (Roche) in 20 mg/mL stock was added and incubation was continued at 55°C for 1 hr ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 μg/ml Laminin (Roche) pre-coated #1.5 Φ12 mm round cover glass (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg/ml inorganic pyrophosphatase (Roche), and 1.5 u/μl of the mutant T7 RNA polymerase (T7 R&DNA polymerase ...
-
bioRxiv - Immunology 2021Quote: ... DNAse I (5 µg/ml, Roche) and 10% FBS (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% glycerol) supplemented with phosphatase (Roche) and protease (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μg/mL DNaseI (Roche). For cell lysis ...
-
bioRxiv - Bioengineering 2023Quote: ... + Insulin (5 ug/mL, Roche 11376497001) + BSA (10 mg/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mg/ml collagen (Roche, 10103578001), and 15 U/ml Dispase II (Stemcell Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg/mL phytohemagglutinin (Roche) to generate T cell blasts (29).
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mg/ml collagen (Roche, 10103578001), and 15 U/ml Dispase II (Stemcell Technologies ...
-
bioRxiv - Genomics 2024Quote: ... 5 U Klenow DNA polymerase (Roche), and incubated for 30 min at RT ...
-
bioRxiv - Biochemistry 2019Quote: ... Fisher Bioreagents) (PBS-T) and re-suspended in 50 μl storage buffer (Blocking Reagent for ELISA, 11 112 589 001, Roche Diagnostics) supplemented with ProClin (4812-U ...
-
bioRxiv - Microbiology 2020Quote: IL-6 release over time was studied in the Laboratoriumsmedizin of the Munich University using an ELISA (Roche, Elecsys IL-6).
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA (5∼8 μg) for Nanopore sequencing was end-repaired and ligated via a KAPA Hyper Prep Kit (Cat#KR0961, Kapa Biosystems, Wilmington, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 μL of glycogen (20 mg/ ml) and 5 μl of proteinase K (20 mg/ ml; Roche) were added to the samples and incubated at 37 °C for 2 hours ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Immunology 2023Quote: ... 5 mM CaCl2 and 5 mM MgCl2 with 100× concentrated EDTA-free protease inhibitor cocktail (Roche, pallet). The suspensions were treated with Dounce and added with 25 mU ml−1 apyrase ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-GFP (Roche, 11814460001); mouse monoclonal anti-c-myc 9E10 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... or 1:500 mouse αFLAG (Roche) and 2° 1:5,000 sheepαmouse (Amersham).
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-BrdU (Roche, Basel, Switzerland) mixed in TBS+ solution for 30-48 h ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-GFP (1:300, Roche), rabbit anti-GFP (1:300 ...
-
bioRxiv - Cell Biology 2019Quote: ... probing with mouse anti-GFP (Roche) and anti-α-Tubulin antibodies [DM1A] (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-HA (1:500; Roche). To improve the immunoreactivity of some synaptic markers ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-Myc mouse monoclonal antibodies (Roche) or anti-GFP mouse antibodies (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-GFP mouse antibodies (Roche) followed ...
-
bioRxiv - Systems Biology 2021Quote: ... and GFP (mouse monoclonal; Roche Diagnostics). For microscopy ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche, 1:1000). Shield-1 (Shld1 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse anti-GFP (Roche, 11814460001). Secondary antibodies were anti-mouse or anti-rabbit HRP conjugates (Dianova ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP mouse monoclonal antibody (Roche); anti-mCherry mouse monoclonal antibody (Abmart) ...
-
bioRxiv - Developmental Biology 2022Quote: ... or mouse anti-Biotin (Roche#1297597) primary antisera followed by appropriate AlexaFluor488 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... mouse anti GFP (1:100, Roche), Rabbit anti Dh44 (0.6:100) ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Roche, Basel, Switzerland), mouse/rabbit anti-Pfs230 [49] ...
-
bioRxiv - Microbiology 2022Quote: ... A mouse anti-GFP antibody (Roche) was used as the primary antibody at a 1:500 dilution in blocking buffer overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-GFP (Roche, 11814460001).
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-HA (1:500; Roche), rabbit anti-V5 (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-GFP (1:2000, Roche), and mouse anti-Actin (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-HA (clone 12CA5, Roche), mouse anti-GFP (clones 7.1 and 13.1 ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-HA (12CA5 mouse mAb, Roche), anti-ubiquitin (P4D1 mouse mAb ...