Labshake search
Citations for Roche :
251 - 300 of 6350 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: 100 pmol gapmers (Supplemental Table S4) were labeled with biotin-16-ddUTP (Jena) and a 2nd generation DIG-oligonucleotide 3’end-labeling kit (Roche) using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer ...
-
bioRxiv - Neuroscience 2020Quote: DNA was extracted from mouse ear biopsies using High Pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: DNA was extracted from tail or ear clippings using the Kapa Mouse Genotyping Standard kit (KAPA Biosystems) and stored at -20°C ...
-
bioRxiv - Molecular Biology 2024Quote: Genomic DNA (gDNA) was isolated from mouse ear punch biopsies using the PCR Template Preparation kit (Roche). Targets was PCR amplified using Taq Polymerase (Roche ...
-
bioRxiv - Immunology 2021Quote: ... Mouse (Roche) on the LightCycler 2.0 (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 spike protein monoplex IHC was conducted using a Chromomap DAB IHC kit (Roche, Basel, Switzerland) with CC1 antigen retrieval at 95°C for 64 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... tissues were dissected in ice cold 1x PBS and transferred to low binding PCR tubes containing 50-100µL of 1x Protease Inhibitor Cocktail in 1xPBS (cOmplete mini EDTA-free; Roche) on ice ...
-
bioRxiv - Genomics 2020Quote: ... and mixed with 100 μL Binding Buffer (1% Triton X-100, 0.1% Sodium Deoxycholate, 1x complete protease inhibitor (Roche)) plus 100 μL 0.2 μg/μl chromatin followed by overnight incubation on a rotating platform at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were lysed (Avestin Emulsiflex C5) in lysis/binding buffer (20mM phosphate [pH7.4], 500mM NaCl, 20mM imidazole, protease inhibitor cocktail [Roche]), clarified lysate was applied to a 5mL HisTrapHP column (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... beads were washed with150 μL cold BSA/PBS for 3 times and mixed with 100 μL Binding Buffer (1% Triton X-100, 0.1% Sodium Deoxycholate, 1x complete protease inhibitor (Roche)) plus 100 μL 0.2 μg/μl chromatin followed by overnight incubation on a rotating platform at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Hi5 cells were harvested by centrifugation and resuspended in binding buffer (50 mM Tris, 300 mM NaCl, pH 8.0) with 1 mM PMSF and protease inhibitors (Complete, Roche). The cells were lysed by sonication and pelleted for 20 min at 21,000g using a 4°C Eppendorf 5424 centrifuge ...
-
bioRxiv - Biochemistry 2023Quote: ... resuspended in binding buffer (50 mM Tris pH 8.0, 10 mM imidazole, 500 mM NaCl) supplemented with cOmplete protease inhibitors (Roche), and sonicated ...
-
bioRxiv - Biochemistry 2023Quote: ... then the pellet was resuspended in 40 ml binding buffer (50 mM NaPi, 300 mM NaCl, 5 mM imidazole, pH 7.5) containing protease inhibitor (Roche cOmplete EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2024Quote: Ni-NTA Magnetic Agarose Beads were incubated with 1.5µg of recombinant His-TIRR(8) in binding buffer (50mM Tris pH 7.4, 150mM NaCl, 5mM MgCl2, 10% Glycerol, Protease inhibitors (EDTA free, Roche)) for 1 hour at 4°C on a wheel ...
-
bioRxiv - Immunology 2022Quote: Full-length HIV clones were quantified by reverse transcriptase (RT) enzyme-linked immunosorbent assay (ELISA) (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RNA from cell culture and mouse heart tissue was extracted using high pure RNA isolation kit (Roche, 11828665001) and miRNeasy Mini kit (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... RNA from mouse brainstem or primary cell cultures was isolated using the High Pure RNA Isolation Kit (Roche). HiPSC-derived cells were lysed in RLT Plus buffer (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... Harvested cells were washed once with PBS and resuspended in His-Trap binding buffer (50 mM Tris, pH 8; 150 mM NaCl; 20 mM imidazole; protease inhibitor cocktail (Roche) and 50 μM NBQX to displace glutamate and promote dimerization) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 and 12h node induced and contralateral uninduced tissues were dissected in ice cold 1x PBS and transferred to low binding PCR tubes containing 1x Protease Inhibitor Cocktail in 1xPBS (cOmplete mini EDTA-free; Roche) on ice ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were collected by centrifugation and re-suspended in Binding Buffer (PBS containing: 2 x cOmplete EDTA-free protease inhibitor cocktail [Roche] ...
-
bioRxiv - Immunology 2023Quote: The concentration of serum free testosterone was calculated via the Vermeulen equation [34] using the concentration of serum sex hormone binding globulin and albumin determined using a Cobas C system (Roche) via electrochemiluminescence (Elecsys SHBG ...
-
bioRxiv - Biochemistry 2023Quote: ... Pellets were resuspended in binding buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 5 mM TCEP) supplemented with protease inhibitors (Roche cOmplete), sonicated ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DIG-labeled 3’UTR of Emi2 and cyclin B1 RNA probes were synthesized with a DIG-RNA-labeling kit (Roche Molecular Biochemicals). Two μg of probes was incubated with purified Flag-tagged proteins for 15 min ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Microbiology 2020Quote: ... and prepared for shotgun metagenomic sequencing using the Kapa Hyperprep Plus kit with 3 rounds of PCR amplification (Kapa Biosystems, Wilmington, MA), and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-agarose and protein A-agarose beads were from Roche. GFP-Trap®-A beads were from Chromotek (Planneg-Martinsried ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... GFP (mouse, Roche, 11814460001 ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA prepared using the KAPA Express reagent (a component of the KAPA Mouse Genotyping Kit from Roche, 07961804001) and analyzed for both CRISPR lesions and repeat size as described below.
-
bioRxiv - Molecular Biology 2023Quote: Protein lysate prepared as described above (750 µg for an over-expressed protein) was precleared with 30 µL of protein G or protein A agarose beads (Roche # 10042392 and Invitrogen # 15918-014 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Immunology 2020Quote: ... cells were cotransfected with both the reporter gene and one of the different putative transcription factors using X-tremeGENE 9 (Roche) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... The gDNA levels corresponding to the viral genes and the housekeeping wasp gene (elongation factor (ELF-1)) were determined using the LightCycler 480 System (Roche). The cycling conditions involved heating at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Biochemistry 2019Quote: ... The transfection of GFP-RNase H1 R-loop-binding domain (GFP-HB) for R-loop detection into HEK293 cells was performed with the FuGENE Transfection reagent (Roche, E269A).
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...