Labshake search
Citations for Roche :
101 - 150 of 10000+ citations for Mouse Calcitonin Gene Related Peptide Type 1 Receptor CALCRL ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... mouse monoclonal anti-HA (1: 500; Roche), mouse monoclonal anti-HPV-16 E7 (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP mouse (11814460001, Roche 1:1000), anti-MYPT1 mouse (sc-514261 ...
-
bioRxiv - Microbiology 2022Quote: ... 1:1000 anti-GFP (Mouse. Roche 11814460001), 1:5000 anti-rabbit HRP (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2022Quote: ... mouse anti-GFP (monoclonal; 1:5000; Roche), goat anti-rabbit HRP (polyclonal ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-mouse GFP (1:1000) (Roche, #11063100). Secondary antibodies used were ...
-
bioRxiv - Cell Biology 2021Quote: ... using anti-GFP (1:250) (mouse, Roche) and anti-gamma-Tubulin (1:250 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Roche #11814460001, 1:1000), rabbit anti-HRI (Mybiosource #MBS2538144 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-biotin (1:250 Roche, 1297597), donkey anti-Sheep IgG Secondary Antibody ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse monoclonal anti GFP (Roche, 1:500), guinea pig polyclonal anti HTP-3 (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (1:500; Roche, 11667149001), rabbit anti p-AKT (T296 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-GFP (1:1,000 dilution, Roche), rabbit anti-GFP (1:1,000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse-anti-BrdU (1:500; Roche, 11170376001), rabbit-anti-DCX (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... mouse anti-GFP (1:1000, Roche Diagnostics) and rabbit anti-mCherry (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GFP (mouse monoclonal, Roche, 1:400), anti-SYP-1 (goat ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (1:200, 11814460001, Roche), mouse anti-Ac-tub (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... peptide-N-glycosidase F (PNGase F) (Roche), neuraminidase (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: ... or X-treme GENE HP (Roche) reagents according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Reference genes from Roche (Proprietary sequence) mGapdh (5046211001 ...
-
bioRxiv - Cancer Biology 2022Quote: The activity of telomerase in the cell lines was detected using the TeloTAGGG telomerase PCR ELISA Kit (Roche, Cat# 12013789001). The assay was performed according to the manufacturer’s instructions and repeated in triplicate ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound biotin peptides were then detected by incubating with 1 U/ml of HRP-conjugated streptavidin (Roche) on ice for 45 min in PBS/0.1% Triton X-100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 U/mL dispase type I (Roche), 10 μM Y-27632 (OrganRegen ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2−ΔΔCt method.14 All primers are listed (Supplemental Table 2S).
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2-ΔΔCt method.65 All primers for target genes are listed (Supplemental Table 5S).
-
bioRxiv - Cancer Biology 2019Quote: ... and the androgen receptor (AR) (RTU; rabbit, #760-4605, clone SP107; Roche, Basel, Switzerland). Staining was detected by the application of 3,3-diaminobenzidine (DAB) ...
-
bioRxiv - Neuroscience 2020Quote: ... at a ratio of 4.5:4.5:1 (GluN1/GluN2A/EGFP) using X-treme GENE HP (Roche) (for details on cell culture and transfection see Amin et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Roche #1814460001; WB 1:1000; IF 1:200), rabbit anti-FLAG (Cell Signaling Technology 2368 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The enzyme digestion was carried out by digestion buffer (calcium-free Tyrode buffer supplemented with hyaluronidase [Worthington, 0.1 mg·ml-1, LS005477] and collagenase type B [Roche, 0.35 U·ml-1, 11088807001]). The left ventricle was collected after 10 minutes’ digestion and cut into small pieces ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sense and antisense digoxigenin-labeled RNA probes were prepared from a BglII-digest of the pMPX2-1 mouse Pax6 cDNA clone (25) using a DIG RNA labeling kit (Roche). Hybridization and stringent posthybridization wash steps were performed at 65°C.
-
bioRxiv - Cancer Biology 2020Quote: Cell proliferation was measured by determining the extent of 5-Bromo-2’-deoxy-uridine (BrdU) incorporation into DNA of U87-MG cells using the BrdU cell proliferation assay ELISA kit (Roche, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse monoclonal to GFP (Roche #11814460001, 1:2000), Rabbit monoclonal to LRRK2 phospho-S1292 (Abcam #ab203181 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-GFP (1:200 dilution; Roche, 11814460001) was used for staining Cse4-GFP and rat anti-HA (1:200 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... or 1:2500 mouse anti-GFP antibodies (Roche) in 1× PBS-T (0.140 M NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-GFP (WB, 1:1000, Roche, 11814460001), rabbit anti-GFP (WB ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (Roche, 11814460001, WB 1:2000), rabbit anti-mCherry (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... Primary (mouse 12CA5 anti-HA (1:5000 Roche), rabbit anti-aldolase (1:5000 abcam) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse anti-GFP (1/600; Cat#11814460001, Roche). The secondary antibodies used were ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:1000 mouse monoclonal anti-GFP (Roche, 11814460001), 1:1000 mouse monoclonal anti-HA (3F10 ...
-
bioRxiv - Microbiology 2019Quote: ... Primary (mouse 12CA5 anti-HA (1:4000, Roche), rabbit anti-EXP2 (1:5000,70) ...
-
bioRxiv - Genetics 2021Quote: ... mouse anti-Myc (1:50, 9E10, Roche, Indianapolis), mouse anti-Flag (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... including mouse anti-BrdU antibody (1:500; Roche), rabbit anti-p75NTR (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (1181446000, Roche, WB 1:1000), mouse anti-WIPI2 (MCA5780GA ...
-
bioRxiv - Microbiology 2023Quote: ... anti-GFP (mouse, 1:1k, Sigma, 11814460001 (Roche)) ...
-
bioRxiv - Plant Biology 2023Quote: ... α-GFP(mouse)-1:1500 (Roche Diagnostics, Basel, Switzerland), α-RFP(rat)-1:1,000 (ChromoTek ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse α-GFP antibodies (dilution: 1:2,000) (Roche) were used together with horseradish peroxidase-conjugated sheep α-mouse immunoglobulin G (dilution ...
-
bioRxiv - Genetics 2024Quote: ... 1:1000 anti-mouse GFP antibody (#11814460001, Roche), 1:1000 anti-mouse α-tubulin antibody (#T9026 ...
-
bioRxiv - Microbiology 2024Quote: ... Mouse α-GFP antibodies (dilution: 1:2,000) (Roche) were used together with horseradish peroxidase-conjugated sheep α-mouse immunoglobulin G (dilution ...
-
bioRxiv - Molecular Biology 2019Quote: ... Apoptosis was measured by Cell Death Detection ELISA (Roche). For reporter assays ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B phosphotranferase (HYG) or blastacidin S deamidase gene (BSD) generated using the PCR DIG Probe Synthesis Kit (Roche). The blot was developed according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...