Labshake search
Citations for Roche :
401 - 450 of 2897 citations for Lysophosphatidic Acid Receptor 5 LPAR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Neuroscience 2021Quote: ... human iPSC-derived neuronal cultures and N2a cells were collected in Lysis Buffer (50 mm Tris-Base, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholic acid) with protease inhibitor (Roche) and phosphatase inhibitor cocktails II and III (Sigma ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Microbiology 2021Quote: ... Bound primary antibodies were detected using biotin-conjugated anti-rat antibody (Roche, 1:1,000) and AlexaFluor594-conjugated streptavidin (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 20 uL/mL Liberase TL (5 mg/ml, Roche) and 50 U/ml DNAse I (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Molecular Biology 2021Quote: ... followed by addition of pefabloc (Roche, 5 mM final concentration) and then dialyzed into 10 mM Tris pH 7.5 with 2 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by addition of pefabloc (Roche, 5 mM final concentration), then dialyzed into 10 mM tris(hydroxymethyl)aminomethane (Tris ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5% glycerol) containing 1×EDTA-free protease inhibitor cocktail (Roche), sonicated and centrifuged at 10,000 × g for 5 min twice ...
-
bioRxiv - Immunology 2021Quote: ... containing 20 uL/mL Liberase TL (5 mg/ml, Roche) and 50 U/ml DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 mg/mL eComplete Mini protease inhibitor tablet (Roche). Lysates were sonicated for 10 seconds 8 times in an ice-cold water bath and centrifuged to separate the protein extract ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% glycerol) plus cOmplete protease inhibitor cocktail without EDTA (Roche). The suspension was clarified by a series of consecutive centrifugations (500 × g for 10 min ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 μl of KAPA2G Fast HotStart ReadyMix (KK5603, KAPA Biosystems) and 3.5 μl of sterile water were mixed in a 10 µl reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl RNase A (2.5 g, DNase-free, Roche #11119915001) or dH2O ...
-
bioRxiv - Immunology 2019Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) or 20 μM nigericin (N-7143 ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL of 2x Kapa library amplification mix (Roche, KK2702), 0.2 µL forward primer (10 µM ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche) in NTMT pH9.5 solution (100mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, #11383221001, Roche) and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 U/mL rabbit pyruvate kinase (Roche Diagnostics, Cat# 10128155001), 8 U/mL lactate dehydrogenase (Sigma-Aldrich)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM BME) including cOmplete EDTA-free protease inhibitor (Roche) and subjected to lysis by sonication ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM BME) including cOmplete EDTA-free protease inhibitor (Roche) and subjected to lysis by sonication ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mg DNase I (from Bovine Pancreas grade II, Roche) was added to 50 mL of lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5% Na deoxycholate) supplemented with protease/phosphatase inhibitor cocktail (Roche) and clarified from the nuclei by centrifugation at 13,000×g for 10 min at 4°C for quantitative western blot analysis (see below) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% glycerol and mini-complete EDTA-free protease inhibitor (Roche)) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM β-mercaptoethanol supplemented with protease inhibitor cocktail (Roche). Cell lysis was accomplished by sonication ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol and protease inhibitors (Complete Protease Inhibitor Cocktail, Roche). The lysate was centrifuged at 160,000 x g for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... phosSTOP phosphatase inhibitor mixture (0.5 tablet for 5 mL, Roche) and 1% n-octylglucoside in 50 mM ammonium bicarbonate (ABC ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% glycerol) supplemented with EDTA-free cOmplete protease inhibitor (Roche). Samples were incubated on ice with intermittent agitation by pipetting for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol] supplemented with EDTA-free protease inhibitor cocktail (Roche), sonicated ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in detection buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... together with 5 µl of a 1kB DNA Ladder (Roche). The electrophoresis was performed at 90 V constant.
-
bioRxiv - Microbiology 2021Quote: ... 5% glycerol) with cOmplete EDTA-free protease inhibitor cocktail (Roche) and disrupted by sonication for 3 min (10 s ON ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and midazolam (5 mg/ml; Hoffmann - La Roche, Hvidovre, Denmark), respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1 μl FastStart Taq Polymerase (5 U/μl, Roche Diagnostics) and 1 μl of fivefold diluted primary WTA product ...
-
bioRxiv - Microbiology 2019Quote: ... 5 mM 2-mercaptoethanol and 1 × protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Neuroscience 2019Quote: ... containing 5 mM EDTA and complete protease inhibitors (Roche, 11836153001). The lysate was centrifuged at 30,000 x g for 20 min at 4°C and the soluble fraction was used for immunoprecipitation ...
-
bioRxiv - Biophysics 2019Quote: ... 5 mM Imidazole and cOmplete™ Protease Inhibitor Cocktail (Roche)) and then lysed using high pressure homogenizer (Avestin Emulsiflex C3) ...
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... blocked with 5% blocking solution (Roche, 11 921 637 001) in PBT for at least two hours at room temperature ...