Labshake search
Citations for Roche :
151 - 200 of 339 citations for L Phenylalanine N T Boc 13C9 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... bovine serum albumin in TBS-T and incubated for 16 h at 4°C: mouse anti-GFP (1:1000) (Roche), sheep anti-CK1α (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Digxigenin (DIG)-labeled sense and antisense probes were performed from the linearized pGEM-T-easy plasmids using the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Neuroscience 2022Quote: ... At DIV 17 cells were washed with ice-cold PBS and immediately extracted with ice-cold T-PER protein extraction buffer (Pierce) supplemented with inhibitors for proteases and phosphatases (Roche). The lysates were centrifuged at 15000 g for 15 minutes at 4°C and the supernatants were used for further analysis.
-
bioRxiv - Genetics 2022Quote: ... RNA-seq libraries of template molecules suitable for high throughput sequencing were established from 300ng of total RNA using the KAPA RNA HyperPrep Kit after a first step of purification using poly-T oligo-attached magnetic beads (Roche). Libraries were sequenced on the Illumina Hiseq 4000 sequencer as paired-end 100 base reads ...
-
bioRxiv - Neuroscience 2022Quote: ... homogenized on ice in 5 volumes (w/v) of T-per extraction buffer complemented with protease inhibitor tablets (Complete Mini Protease Inhibitor Tablets, Roche) and phosphatase inhibitor cocktail tablets (phosSTOP ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissues were homogenized on ice in 5 volumes (w/v) of T-per extraction buffer (Pierce, USA) complemented with protease inhibitor tablets (Complete Mini Protease Inhibitor Tablets, Roche) and phosphatase inhibitor cocktail tablets (phosSTOP ...
-
bioRxiv - Bioengineering 2021Quote: ... P14 CD8+ T cells were activated for 24 h as described above and resuspended in T cell media + 30 U/ml rhIL-2 (Roche) at 2 × 106 cell/ml ...
-
bioRxiv - Biophysics 2021Quote: ... including 200 μM final concentration of each dNTP (G,C,T,A) and 10 µM Bio-16-dUTP or Dig-11-dUTP (all from Roche). Labelled handles specifically bind either to a glass surface covered with anti-digoxigenins or to superparamagnetic beads covered with streptavidin ...
-
bioRxiv - Physiology 2020Quote: 1 μg RNA was reverse transcribed into cDNA with Oligo(d)T primers using the Transcriptor First Strand cDNA Synthesis kit (Roche). The qRT-PCR was performed with the LightCycler 480 SYBR Green I Master mix (Roche ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Bioengineering 2023Quote: ... where a small opening (≈ 0.5 mm) was made using Accu-Check® Safe-T-Pro Plus lancing device (Roche AG) pricking needle ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 mmol/L β-glycerophosphate) and protease inhibitors (Protease Inhibitor Cocktail Tablets, Roche). Protein concentration was determined using a Bradford Protein Assay Kit (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... L-lactate accumulated in the medium was detected using a Cobas c311 Analyser (Roche). Secondly ...
-
bioRxiv - Genomics 2023Quote: First-round L-PCRs were performed using KAPA HiFi HotStart ReadyMix (Roche Molecular Systems). Reactions (50 μl ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM L-Glutamine (R10) (Thermo 25030081) + 10 IU/mL IL-2 (Roche 11011456001) after CD3/CD28 stimulation ...
-
bioRxiv - Genomics 2020Quote: ... all multiplexed single-cell libraries (n = 30) were quantified using the KAPA Library Quantification Kit for Illumina Platforms (Roche) and pooled in an equimolar ratio ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant was incubated for o/n with 40μl of anti-HA agarose beads (rat anti-HA, 3F10 Roche) at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μg of total RNA was separated on a denaturing 1.2% agarose gel and blotted on a Hybond-N+ (Roche) membrane ...
-
bioRxiv - Microbiology 2020Quote: ... separated by electrophoresis in a 0.8% agarose gel and transferred onto a nylon membrane (Hybond N+, Roche Molecular Biochemicals). The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals ...
-
bioRxiv - Neuroscience 2019Quote: ... some TK rats (n=11) were orally administered 4 mg of valganciclovir (val) to reduce neurogenesis (Hoffman La-Roche; delivered in 0.5 g peanut butter + chow pellets ...
-
bioRxiv - Developmental Biology 2020Quote: ... Whole cells extract was isolated using RIPA buffer (NaCl 150mM – Tris HCL pH7,35 50mM – DOC 1% – N-P40 1% – H2O) supplemented with protease inhibitor (04 693 116 001, Roche). Isolated protein concentration was determined using Bradford assay (500-0006 ...
-
bioRxiv - Genetics 2020Quote: ... pellets were thawn and re-suspended in 400 μl of lysis buffer (50mM HEPES pH7.5, 150mM NaCl, 5mM MgCl2, 40mM N-Ethylmaleimide, EDTA-free protease inhibitor cocktail (Roche) and 2mM PMSF (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... with their respective dilution in 5% skimmed milk in PBS-tween 0.1% were used: anti-HA-HRP (3F10) (N°12013819001, Roche) 1/10,000 ...
-
bioRxiv - Immunology 2021Quote: ... membranes were washed three times in TBS-T followed by blocking in 10% (v/v) western blotting reagent (Roche, Basel, Switzerland) for 1–2 h at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... Fisher Bioreagents) (PBS-T) and re-suspended in 50 μl storage buffer (Blocking Reagent for ELISA, 11 112 589 001, Roche Diagnostics) supplemented with ProClin (4812-U ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Epidemiology 2019Quote: ... N-terminal pro-brain natriuretic peptide (NT-proBNP) and high-sensitive cardiac troponin T (hs-TnT) were determined on the same analyzer by immunoturbidimetry assays (Roche Diagnostics). Lipoprotein A-I (containing apoA-I but not apoA-II ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Bioengineering 2022Quote: siRNAs and plasmids were transfected using DharmaFECT 1 transfection reagent (Dharmacon T-2001) and X-tremeGENE9 DNA transfection reagent (Roche 06365809001) respectively ...
-
bioRxiv - Bioengineering 2023Quote: ... lung tissues were thawed on ice and then resuspended in 0.5ml of Tissue Protein Extraction Reagent (T-PER) (ThermoScientific, cat# 78510) containing Complete Mini Protease Inhibitor Cocktail (Roche, cat# 11836170001). Tissues were homogenized using an electric handheld tissue homogenizer and were stored at -80°C until used for ELISA.
-
bioRxiv - Plant Biology 2023Quote: ... The membrane was washed with TBS-Tween 20 (TBS-T) and developed using freshly dissolved NBT/BCIP (NBT/BCIP Ready-to-Use Tablets, Roche, 11697471001) solution until the band appeared.
-
bioRxiv - Cancer Biology 2023Quote: ... the T cells were activated in X-VIVO 15 containing 150 U/mL of human IL-2 (#Ro 23-6019, Roche, Switzerland), 10 ng/mL of recombinant IL-7 (#200-07 ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were washed three times with TBS-T and were incubated with a TUNEL reaction mixture (In Situ Cell Death Detection Kit, TMR red, Roche 12156792910) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Cell Biology 2019Quote: ... ground yeast powder was solubilized in 4 volumes of homogenization buffer (400 mM trisodium citrate, pH 8, 0.5% n-Dodecyl β-D-maltoside) and protease inhibitor cocktail (Roche). The soluble fraction was incubated with 10 μl magnetic beads (Dynabeads ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...